Labshake search
Citations for Thermo Fisher :
1801 - 1850 of 10000+ citations for lefty A TGF beta 4 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells are differentiated for 4 days in embryonic body (EB) differentiation medium (DMEM/F12 [Hyclone], 20% FBS, NEAA [1×, GIBCO], GlutaMAX [1×, GIBCO], 0.1% beta-Mercaptoethanol [GIBCO]). For mixed embryonic body (EB ...
-
bioRxiv - Genomics 2019Quote: ... with 1% beta-mercaptoethanol for Smart-seq2 and 384-well plates containing 0.6 µl 1% NP40 (Thermo Fisher Scientific) for CEL-Seq2.
-
bioRxiv - Cancer Biology 2020Quote: ... Tumor-bearing mice were administered 25 mg/ kg of MeTC7 or vehicle control (40% Hydroxypropyl-beta-cyclodextrin [Acros Organics] & solutol HS15 [Sigma] in sterile water ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR was performed using TaqMan probes (DR4: Hs00269492_m1, DR5: Hs00366278_m1, beta-2-microglobulin: Hs00187842_m1) and TaqMan Gene Expression Master Mix (Life Technologies Limited) as per the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies for one series included rabbit anti-beta Amyloid (1:300, Cat# 715800, Lot# SH257822; Invitrogen, Waltham, MA). Primary antibodies for another series included rat anti-glial fibrillary acidic protein (1:2500 ...
-
bioRxiv - Microbiology 2021Quote: ... TATA-box binding protein (TBP) (Hs00427620_m1) and beta-2-microglobulin (B2M) (Hs00187842_m1) was used (all from Thermo Fisher Scientific). PCR was performed using the LightCycler 480 Instrument (Roche Life Science ...
-
bioRxiv - Microbiology 2020Quote: ... was suspended in 600 μL of Qiagen RLT lysis buffer supplemented with one percent beta-mercaptoethanol and 0.3 U/μL Superase-In (Invitrogen). The suspension was subjected to bead beating for 3 minutes using 1.0 mm Zirconia/Silica beads ...
-
bioRxiv - Microbiology 2020Quote: ... Bacterial pellets were suspended in 600 μL Qiagen RLT lysis buffer supplemented with one percent beta-mercaptoethanol and 0.3 U/μL Superase-In (Invitrogen). The suspension was subjected to bead beating for 3 minutes using 1.0 mm Zirconia/Silica beads ...
-
bioRxiv - Neuroscience 2022Quote: ... mice received a unilateral injection of cholera toxin beta subunit coupled to Alexa Fluor 594 (CTb-594, Invitrogen C34777). Mice were anesthetized with isoflurane and treated with proparacaine ophthalmic drops (1%) ...
-
bioRxiv - Neuroscience 2024Quote: ... Both fractions were then used to measure the amyloid beta 1-42 (Aβ1-42) using a specific ELISA kit (Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Primer pairs specific to mouse RFC1/SLC19a1 (Mm00446220_m1) and Tubb4a (Mm00726185_s1, beta 4A class IVA as a housekeeping gene) were constructed and verified by Life Technologies to use with TaqMan qPCR chemistry (TaqMan™ Gene Expression Assay ...
-
bioRxiv - Cancer Biology 2023Quote: The MCF7 cells were grown in their aforementioned media (see section 2.3) and treated with 10nM beta-estradiol in DMEM no phenol red (Gibco), 2% charcoal-stripped FBS (cFBS) ...
-
bioRxiv - Biochemistry 2023Quote: ... 10x serial dilutions were made in 0.1% formic acid 0.1% n-Dodecyl-beta-Maltoside Detergent (DDM, Thermo Fisher, 89902) in LCMS grade water ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Cot-1 DNA (Invitrogen), 3M NaAc and 100% cold EtOH ...
-
bioRxiv - Cancer Biology 2024Quote: Recombinant human EGF (Gibco #PHG0311) was added to the medium of NCI-H23 or H23 KO cells at 80% confluency to reach a final concentration of 100 ng/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Pool Set v3.0 (Thermofisher) and TaqMan™ MicroRNA Reverse Transcription Kit (Thermofisher) ...