Labshake search
Citations for Thermo Fisher :
1801 - 1850 of 6562 citations for SIRPA Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Microbiology 2019Quote: Bacterially expressed ZIKV EDIII proteins (C-terminal 6 × His-tag) were conjugated to Ni-NTA Magnetic beads (Thermo Scientific) following manufacturers protocol ...
-
bioRxiv - Molecular Biology 2019Quote: ... SmBChE1 and SmAChE3 (fSmChEs) were EcoRI/XbaI cloned into the C-terminal 6-His-tagged pPICZαA expression vector (Invitrogen) to facilitate secretory expression ...
-
bioRxiv - Cell Biology 2019Quote: ... Templates were prepared on the Ion Chef system using an Ion PI Hi-Q Chef kit (Thermo Fisher Scientific) and sequencing was performed on an Ion Proton system using with Ion PI Hi-Q sequencing kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... hLIGHT (L83-V240) and mHVEM (Q39-T142) were separately cloned into the pMT/BiP/V5-His A vector (Invitrogen) and co-transfected into Drosophila S2 cells with the pCoBlast (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... were coated at room temperature for 3 hours with 1 μg/mL PolyRab anti-His antibody (ThermoFisher, PA1-983B), followed by overnight blocking with blocking buffer containing 1x PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... which were then separated using SDS-PAGE and visualized using Wester blotting with an anti-his tag antibody (Invitrogen).
-
bioRxiv - Biochemistry 2021Quote: ... which were then separated using SDS-PAGE and visualized using Wester blotting with an anti-his tag antibody (Invitrogen).
-
bioRxiv - Immunology 2021Quote: ... FACS-sorted cells were suspended at 0.5×106 cells/mL in RPMI 1640 medium supplemented with 10% HI-FCS and 1% PenStrep (10378016; Gibco). CD14+HLA-DRneg/low/CD14+HLA-DRhigh monocytes were cultured in 96 well plates (200μL/well ...
-
bioRxiv - Immunology 2021Quote: ... Clonal amplification of the libraries was done using the Ion-PI-Hi-Q Sequencing 200 Kit (Thermo Scientific, USA) PCR emulsions ...
-
bioRxiv - Neuroscience 2023Quote: The plasmid for heterologous expression of fshr-1 in HEK cells was obtained by directionally cloning the fshr-1 cDNA into the pcDNA3.1/V5-His-TOPO vector (Invitrogen). The cDNA sequence of the fshr-1a gene isoform was amplified by PCR using cDNA from mix-staged wild-type C ...
-
bioRxiv - Plant Biology 2023Quote: ... and proteins were visualized using Ponceau stain as well as Western blot with monoclonal anti-His (Invitrogen MA1-21315), and polyclonal anti-GST (Thermo Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... and utilized Alt-R CRISPR-Cas9 crRNA/trRNA/Hi-Fi Cas9 ribonucleotide-protein complex (IDT) and Neon electroporation (ThermoFisher) to deliver the complex to the iPSC ...
-
bioRxiv - Biophysics 2023Quote: ... and from the 3’-terminus by the 10×His-tag nucleotide sequence and inserted into a pFastBac1 vector (Invitrogen) via the BamHI(5’ ...
-
bioRxiv - Immunology 2023Quote: ... Protein detection was performed by incubation with a 6x-His Tag mouse monoclonal antibody (clone: HIS.H8; Thermo Fisher Scientific), followed by a secondary goat-anti-mouse HRP antibody (clone NA9310 N ...
-
bioRxiv - Immunology 2023Quote: ... Proteins containing a His-tag were purified by affinity chromatography using HisPur Ni-NTA resin (Thermo scientific, Cat#88222). Proteins were then eluted with 250 mM imidazole in 50 mM Tris-HCl and 300 mM NaCl ...
-
bioRxiv - Biophysics 2023Quote: ... and the 3C protease was removed using Dynabeads magnetic beads designed for His-tagged protein isolation (Thermo Fisher, 10103D). The supernatant from the magnetic bead pulldown was then concentrated using Amicon 10 kDa centrifugal filter units (MilliporeSigma) ...
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... Sequencing was done using the Ion PI™ Hi-Q™ Sequencing 200 Kit (Thermo Fisher Scientific, Catalog # A26772) on Ion Proton sequencer with sequencing data processing using the Torrent Suite TM Software (Ver ...
-
bioRxiv - Biophysics 2023Quote: ... and from the 3’-terminus by 10×His-tag nucleotide sequence and inserted into the pFastBac1 vector (Invitrogen, USA) via the BamHI(5’ ...
-
bioRxiv - Developmental Biology 2022Quote: ... mCherry-Emp-V5His construct was cloned using Hifi DNA assembly kit (NEB E5520S into the pAc5.1/V5-His A vector (Invitrogen) using the following enzymes Acc65I and XhoI ...
-
bioRxiv - Immunology 2023Quote: HCMV US18 and US20 were amplified from the HCMV TB40/E BAC (accession #EF999921) and subcloned into pcDNA3.1-V5/His (Invitrogen) via the KpnI/NotI sites to generate pcDNA3.1 US18-V5/His and pcDNA3.1 US20-V5/His ...
-
bioRxiv - Molecular Biology 2023Quote: ... ceSMSγ and ceSMSr cDNAs were PCR amplified and ligated into the copper-inducible pMT/V5-His B vector (Invitrogen).
-
bioRxiv - Genetics 2023Quote: ... standard fragment analysis conditions) with 0.8 ul PCR product is loaded in 9.4 ul Hi-Di Formamide (Applied Biosystems), with 0.1 ul GeneScan 500 LIZ (Applied Biosystems) ...
-
bioRxiv - Microbiology 2023Quote: ... and gB[H527P]-His EVs was performed at 300 keV on a Titan Krios electron microscope (Thermo Fisher scientific) equipped with a Gatan K3 (5 μm/pixel ...
-
bioRxiv - Microbiology 2023Quote: ... we initially digested the pNL4-3 plasmid with EcoRI and XhoI and subcloned this fragment into pcDNA3.1/myc-His A (Invitrogen). To generate pcDNA3.1 NL4-3 Env TMTR ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged TpPyShell together with TEV protease was dialyzed overnight at 4°C in SnakeSkin dialysis tube (Thermo Scientific) against dialysis buffer (50 mM Tris-HCl pH8.0 ...
-
bioRxiv - Immunology 2023Quote: ... Amplification and cloning of the truncated versions of TGM4 (D1-3 and D4-5) was performed by PCR amplification using proofreading Taq polymerase Phusion Hi as per the manufacturer’s instructions (Invitrogen), full-length codon-optimised TGM4 as template ...
-
bioRxiv - Genetics 2024Quote: ... and 15 µL of each eluate was mixed with the same volume of Hi-Di formamide (Thermo Fisher Scientific). Samples were finally sequenced either in one or in both directions on a 3500 Genetic Analyzer device (Applied Biosystems/Hitachi ...
-
bioRxiv - Biophysics 2024Quote: ... The cDNA was eluted from Dynabeads using 11 μL Formamide-ROX mix (1000 μl Hi-Di Formamide (Thermo Fisher), 8 μl of 350 ROX size standard (Thermo Fisher) ...
-
bioRxiv - Microbiology 2024Quote: ... Membranes were then incubated for 1 h at room temperature with the following primary antibodies: mouse anti-His-Tag (dilution 1:1,000, clone HIS.H8, Invitrogen MA121315), mouse anti-Flag (dilution 1:1000 ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant AtGNL-6XHIS was detected using an anti-HIS (C-term)/AP antibody at a 1:2,000 v/v dilution (Invitrogen) and CDP-start ...
-
bioRxiv - Neuroscience 2024Quote: ... The coding sequences of a five glycine linker and intracellular GFP and biotin tags followed and were inserted in a pcDNA3.1(-)/myc-His (Invitrogen) vector backbone ...
-
bioRxiv - Cancer Biology 2019Quote: ∼1 x 106 HEK293 cells grown at 70% confluency on 35 mm dish embedded with 12 mm glass viewing area (Nunc, Thermo Fisher Scientific Inc., Waltham, MA, USA) were transfected with appropriate plasmids using Lipofectamine 3000 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The T cells were isolated using the EasySep human T cell isolation kit (Stemcell) and activated with human T-activator CD3/CD28 Dynabeads (Gibco) at a bead:cell ratio of 1:1 ...
-
bioRxiv - Microbiology 2021Quote: ... which is composed of two ACE2 ectodomains linked to the Fc portion of the human IgG (Anand et al., 2020).Alexa Fluor-647-conjugated goat anti-human Abs (Invitrogen) were used as secondary antibodies to detect ACE2-Fc and plasma binding in flow cytometry experiments.
-
bioRxiv - Molecular Biology 2022Quote: In vitro sumoylation reactions were performed on protein array slides with more than 9000 human proteins spotted (ProtoArray® Human Protein Microarray v5.0, Invitrogen). The reaction was performed by the technical service of Invitrogen with our purified enzymes ...
-
bioRxiv - Immunology 2022Quote: ... For Cytokine Multiplex of Human Inflammation Panel (Invitrogen™ Inflammation 20-Plex Human ProcartaPlex™ Panel) (Catalog # EXP20012185901, eBioscience/Invitrogen) procedures were performed following manufacturer protocol and the plate was processed on BioRad Bio-Plex 200 system with Bio-Plex-HTF attachment (Bio-Rad ...
-
bioRxiv - Cancer Biology 2022Quote: RNA was isolated from human NSCLC cells and human clinical NSCLC tumor and normal samples by homogenization in Trizol reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... supernatants were diluted 4-fold and assayed with the Amyloid beta 40 Human ELISA Kit and either the Amyloid beta 42 Human ELISA Kit or the Amyloid beta 42 Human ELISA Kit Ultrasensitive (Invitrogen), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Enzyme-linked immunosorbent assays (ELISAs) for human IL-8 were performed using the Human IL-8 ELISA Kit (ThermoFisher SCIENTIFIC) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: HMF and MRC5 fibroblasts were transfected with a pool of 3 siRNAs targeting each of the 710 human kinases (Silencer Human Kinase siRNA Library, #A30079 Thermofisher). Fibroblasts (1250 cells/well ...
-
bioRxiv - Immunology 2019Quote: ... human PBMC derived T cells were purified by Human T cell isolation kit from Invitrogen (Invitrogen Dynal AS, Oslo, Norway) according to manufacturer’s instruction ...
-
bioRxiv - Bioengineering 2019Quote: ... Samples were rinsed and re-suspended in flow buffer containing 25 μL mL−1 of each of the following monoclonal anti-human antibodies per sample: anti-human CD3-AF700 (56-0037-42, ThermoFisher), - CD40L/CD154-FITC (11-1548-42 ...
-
bioRxiv - Immunology 2021Quote: ... and total T cells were purified from PBMC suspensions by negative immunomagnetic selection (purity >90%) using the Human Myeloid DC Enrichment Kit (STEMCELL) and the Untouched total human T cell (Invitrogen) kits ...
-
bioRxiv - Cancer Biology 2022Quote: ... primary human breast CAFs were transfected with 75 nm human periostin-targeting stealth siRNA (si-POSTN) (ThermoFisher siRNA ID: HSS116400) or 75 nm non-targeting control siRNA (si-Control ...
-
bioRxiv - Cell Biology 2022Quote: ... were prepared from fresh human umbilical veins as previously described (Barbieri et al., 1981) and maintained in Human Endothelial SFM (Gibco™ ...
-
bioRxiv - Microbiology 2022Quote: ... Surface PCDH1 was stained using human anti-EC7 mAb-3677 (5 µg/mL) followed by anti-human Alexa FluorTM 555 (ThermoFisher) for 1 h at 4°C each ...
-
bioRxiv - Microbiology 2022Quote: ... encoding full-length human MCT1 (uniprot ID: P53985) and human basigin (uniprot ID: P35613-2) were cloned individually into pFastBac vector (Invitrogen) for recombinant expression in Sf9 cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... human ETAR (residues 21-406) and human ETBR (residues 27-424) DNA was cloned into a modified pFastBac vector (Invitrogen), which contains an N-terminal FLAG tag (DYKDDDD ...
-
bioRxiv - Neuroscience 2023Quote: ... The human FUS or human TARDBP cDNA was subcloned into the pENTR™/D-TOPO® vector (Thermo Fisher Scientific). To generate the Gateway destination vector pUAST-DEST ...