Labshake search
Citations for Thermo Fisher :
1801 - 1850 of 10000+ citations for Progesterone ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... microtiter plates (MaxiSorp; Nunc) were incubated overnight at 4°C with 50 μL of a solution of in 75 mM sodium carbonate (pH 9.6 ...
-
bioRxiv - Biochemistry 2022Quote: ... 35 mm plates (Nunc™ Cell-Culture Treated Multidishes ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-multiwell plate (ThermoFisher) in E8 medium containing 10 μM Y-27632 (#Y0503 ...
-
bioRxiv - Microbiology 2022Quote: ... TC-plates (Fisher Scientific) at a confluency of approximately 30% and were incubated with 10% serum ...
-
bioRxiv - Biochemistry 2022Quote: 96 well plate (Nunc) was coated overnight with 1 μg/ml of TRIM7-RING-Box ...
-
bioRxiv - Immunology 2023Quote: ... Maxisorp Plates (Nunc, Denmark) were coated overnight with either recombinant MOMP (1μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... delta-surface plates (Nunc) were pre-coated with 12 μg/ml polyclonal anti-hamster IgG (MP Biomedicals ...
-
bioRxiv - Bioengineering 2023Quote: ... clear Maxisorp plates (Nunc) were coated with streptavidin (10 mg/mL ...
-
bioRxiv - Microbiology 2023Quote: ... MaxiSorp plates (NUNC, Denmark) were coated overnight at 4°C with 4 μg/ml UV-inactivated B/Tunis-864 Ct elementary bodies in carbonate buffer pH 9.6 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... plate (Thermo Fisher Scientific), sealed with SealPlate film (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... black microtiter plates (ThermoFisher) and measurement of GFP (excitation 485 nm/ emission 528 nm ...
-
bioRxiv - Immunology 2023Quote: ... MaxiSorp plates (ThermoFisher Scientifc) were coated with 100 ng anti-IgG2b ...
-
bioRxiv - Immunology 2024Quote: ... Immulon 2HB plates (ThermoFisher) were pre-coated with 2μg/mL of goat-α-mouse Ig(H+L ...
-
bioRxiv - Biochemistry 2024Quote: ... MaxiSorp plates (Invitrogen 442404) were coated with ESAT-6 at 5 µg/mL in PBS overnight at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... coated plates (ThermoFisher, #140675) and grown in mESC medium prepared as follows ...
-
bioRxiv - Cancer Biology 2022Quote: The detection of TGF-β in the cell culture media from SH-SY5Y and MDA-MB-231 cells treated with TEPA for 24h was performed according to the protocol suggested by Thermo Fisher (TGF-beta-1-Human-ELISA-Kit/BMS249-4).
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Systems Biology 2020Quote: ... and then cells were fixed and permeated in the plate using a Human Cardiomyocyte Immunocytochemistry Kit (Thermo Fisher Scientific). The primary antibodies included ...
-
bioRxiv - Genomics 2022Quote: ... The concentration of each pooled PCR plate library was measured using a Qubit dsDNA HS Assay Kit (Q32851, Invitrogen) and library fragment distribution was quantified on Agilent Bioanalyzer ...
-
bioRxiv - Plant Biology 2022Quote: ... Four day old seedlings were transferred to MS plates supplemented with 10μM EdU (Invitrogen Click-iT EdU imaging kit) and allowed to grow for 24 hours ...
-
bioRxiv - Microbiology 2022Quote: ... and DNA concentration was quantified on an EnSpire Multimode Plate Reader using a Qubit High Sensitivity dsDNA kit (Invitrogen). Samples were normalised to 5 ng/μL for library preparation and sequencing by Auckland Genomics Ltd on an Illumina MiSeq with 2×300 bp chemistry (samples were demultiplexed by Auckland Genomics).
-
bioRxiv - Neuroscience 2023Quote: ... iPSCs were differentiated into midbrain floor plate progenitors via the PSC Dopaminergic Neuron Differentiation Kit (ThermoFisher, Cat. No. A3147701) in a stepwise fashion comprising two phases ...
-
bioRxiv - Cell Biology 2023Quote: ... and the protein concentration was quantified in a plate reader using a Pierce BCA protein quantification kit (Thermo Fisher). For each condition ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR product was then purified and normalized using SequalPrep Normalization Plate Kit (Thermo Fisher Scientific, Waltham, MA, USA). The purified library was quantified using the KAPA library quantification kit (KAPA Biosystems ...
-
bioRxiv - Cancer Biology 2023Quote: Multiparametric cell cycle analysis was performed using a previously described technique.50 Cells grown in a 96 well plate were incubated with 10µM EdU from the AlexaFluor 647 Click-iT EdU Proliferation kit (Thermofisher) for 8h before being fixed in 4% PFA for 15min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... the media was removed and replaced with 45 µL medium containing SYTOX Green (20 nM final) and 5 µL of 10X compound prepared in a 384-well storage plate (Thermo Fisher Scientific, Cat# AB-0781). Experiments with paired HEK293 and HepG2 control and NGLY1 KO cells were performed by seeding 7500 cells/well into a 96-well plate (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: Gene-specific knockdown was achieved by reverse-transfection of PCa cell suspensions (total 5×105 cells) with 12.5 nM siRNA in 6 well plates using RNAiMAX transfection reagent (Life Technologies; Thermo Fisher Scientific, Scornsby, VIC, AUS), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... using PerfeCta SYBR Green FastMix with low ROX (Quanta Biosciences, Gaithersburg MD) on 384-well plates using an ABI Quantstudio 5 machine (Thermo Fisher Scientific, Foster City, CA) with Quantstudio Design & Analysis software (v1.4.3 ...
-
bioRxiv - Immunology 2022Quote: ... at 37°C and 5% CO2 for 2 h in 12-well Nunclon™ Delta surface-treated flat bottom plates (Thermo Fisher Scientific, Waltham, MA). Non-adherent cells were removed by gently washing the cells with pre-warmed culture medium ...
-
bioRxiv - Neuroscience 2022Quote: ... and luminescence measured as a direct indication of TRKB homodimerization with a plate reader (Varioskan Flash, Thermo Scientific, average of 5 measurements, 0.1 s each) immediately after the injection of the coelenterazine substrate (Nanolight Technology).
-
bioRxiv - Microbiology 2020Quote: ... bacilliformis shifted to liquid medium at pH 7 using a 5’ RACE System kit (Invitrogen; Carlsbad, CA) according to manufacturer’s protocols and with gene-specific primers (S1 Table) ...
-
bioRxiv - Cell Biology 2020Quote: The 5’ and 3’ ends of lncRAP2 was determined using the FirstChoice RLM-Race Kit from Ambion following the manufacturers instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... and reverse (Y2H term reverse: 5’ GGAGACTTGACCAAACCTCTGGCG) primers using Phusion High-Fidelity PCR Kit from Thermo Scientific, with a standard PCR program.
-
bioRxiv - Cell Biology 2021Quote: ... 5 µg of total RNA was treated with DNase (DNA-free Kit for DNase Treatment & Removal; Invitrogen).
-
bioRxiv - Cancer Biology 2020Quote: ... followed by RT-PCR reaction using SYBR Green PCR Master Kit in QuantStudio 5 Systems (Applied Biosystems). Gene expression was normalized to GAPDH using the comparative CT method.
-
bioRxiv - Cell Biology 2021Quote: ... Exon 4 and Exon 5 were amplified (Table M1) and cloned using pJET1.2 cloning kit (Thermo Fisher) before sequencing.
-
bioRxiv - Microbiology 2020Quote: ... 5 μg of purified RNA was treated by DNase from a DNA-free DNA removal kit (Ambion). 125 ng of treated RNA was used to synthesize cDNA by a qScript Felex cDNA synthesis kit (Quanta Biosciences) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μg of purified RNA was treated by DNase from a DNA-free DNA removal kit (Ambion). Reverse transcription and qRT-PCR were performed as described above ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA was synthesized with the 5' RACE System for Rapid Amplification of cDNA Ends kit (Thermo Fisher) using the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: gDNA was harvested from 5 million cells for WT and Cdc42-KOclones (Invitrogen Purelink Genomic DNA Kit). The purified gDNA was then used as a PCR template for primers that flank the CRISPR cut site ...
-
bioRxiv - Developmental Biology 2022Quote: PCR products were used as templates for T7 transcription reactions with the 5× MEGAscript T7 kit (Ambion). dsRNA was injected dorsally in 0-1 hour old embryos from the stocks w ...
-
bioRxiv - Microbiology 2019Quote: ... RNA (5 ng/µL) was reverse-transcribed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). 1 µL of cDNA was used as template in a 10 µL qRT-PCR reaction performed with Power SYBR reagent (Applied Biosystems) ...
-
bioRxiv - Plant Biology 2019Quote: ... and 5 μL of Power SYBR® green RNA-to-CT™ 1-step kit (Applied Biosystems) that has limits of detection as low as 2 copies of the target gene ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 SCID tumor samples and the mT3-2D cell line using the PureLink RNA Mini Kit (Ambion). RNA concentration and quality were assessed using the Agilent BioAnalyzer ...
-
bioRxiv - Molecular Biology 2021Quote: 5-ethynyl-2’-deoxyuridine (EdU)-incorporation assay has been performed using a commercially available kit (Invitrogen, C10340). Animals were injected intraperitoneally with 60 µl of EdU (0.5 mg/ml in 50% DMSO and 50% PBS solution ...
-
bioRxiv - Bioengineering 2022Quote: ... 5’ppp-RNA was prepared by IVT in the absence of ATP using MEGAshortscript T7 kit (Thermofisher) and DNA template ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’-CAGAGTCGATCAGTCTGCATATCTCCA-3’) with the dilution protocol of the Phusion Human Specimen Direct PCR Kit (Thermo Scientific). The PCR product was sequenced directly with a nested sequencing primer (5’-GGTGCTCTCCCGGGTACACAA-3’) ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µg of total RNA was subsequently digested with the DNA-free kit (catalog no. AM1906; Ambion) and diluted 5-fold ...
-
bioRxiv - Cell Biology 2023Quote: The 5’ end of the mouse Pdgfrβ i10 splice variant was elucidated using the GeneRacerTM Kit (Invitrogen). The P90 WT (c57BL/6 ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA (5′-TGTGAATCGTAGGAGCGCTG-3′) was synthesized via in vitro GeneArt™ Precision gRNA Synthesis Kit (ThermoFisher, A29377) following manufacturer’s instructions ...