Labshake search
Citations for Thermo Fisher :
1801 - 1850 of 3080 citations for ANKZF1 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... For the knock down of Plk1 small interfering RNA (siRNA) duplexes AACGAGCTGCTTAATGACGAGTT were used (ThermoFisher). For Astrin siRNA oligo #367 (5′-TCCCGACAAC TCACAGAGAAA -3′)(Qiagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were transfected with siRNA (50 nM) using lipofectamine RNAi MAX (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2020Quote: ... Transfections of siRNA were performed using Lipofectamine 3000 (Invitrogen, cat.no. L3000-015, Carlsbad, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transfected with 20 nM pooled siRNA against NINJ1 (Thermo Scientific, HSS107188, HSS107190, HSS181529) or non-silencing control siRNA (Qiagen ...
-
bioRxiv - Molecular Biology 2020Quote: siRNA transfections were performed in ES cells using Lipfectamine 2000 and OptiMEM (Thermo Fisher Scientific). ES cells were plated 5-7h before transfection at a density of 5 x 105 cells per well of a 6-well plate and transfected with 100 pmol siRNA ...
-
bioRxiv - Molecular Biology 2021Quote: ... and transfected with 15 pmol total siRNAs and 45 µl Lipofectamine RNAiMAX (Thermo Fisher, 13778500) in 1 ml Opti-MEM media (Thermo Fisher ...
-
bioRxiv - Biophysics 2022Quote: Total RNA was extracted from three replicates of NDP52 KD (using CALCOCO2 siRNA, Ambion, 4392420) and scrambled siRNA (using control siRNA ...
-
bioRxiv - Cell Biology 2020Quote: ... Then they were transfected with siRNA (20 nM final concentration) using Lipofectamin RNiMax (Thermo Fisher) in OptiMEM medium ...
-
bioRxiv - Cell Biology 2019Quote: ... and 24 hr later transfected with 30 nM siRNA/3 µl RNAiMax (Thermo Fisher Scientific) for NIH-3T3 cells and P19 cells or 5nM siRNA/8 µl INTERFERin (PolyPlus ...
-
bioRxiv - Systems Biology 2019Quote: ... cells were forward transfected with 30nM siRNA pools at a 1:1:1 ratio (Ambion) using Dharmafect 1 (Dharmacon ...
-
bioRxiv - Cancer Biology 2019Quote: ... siRNAs were transfected at 20 nM for 48h using Lipofectamine RNAiMAX (Life Technologies, Carlsbad, CA). The efficiency was determined by qRT-PCR using TaqMan assay.
-
bioRxiv - Genetics 2019Quote: ... INS832/13 cells were transfected with 20nM TRAPα targeting siRNA (Assay ID 219062, Thermo Fisher) or Negative Control siRNA (AM4611 ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNA was spotted into plates with DharmaFECT 4 transfection reagent (Dharmacon) and Opti-MEM (Gibco), incubating for 20 minutes before adding cells in DMEM with 10% FBS and 2 mM L-glutamine (final concentrations) ...
-
bioRxiv - Cell Biology 2019Quote: ... The cells were transfected the next day with either negative control siRNA (Ctl, from Ambion), a SMARTpool of siRNAs targeting linc00899 or TPPP or siRNAs targeting linc00899 in combination with TPPP ...
-
bioRxiv - Cell Biology 2019Quote: Cells were transfected with 10 pmol of siRNA using the Lipofectamine RNAiMAX Transfection Reagent (Invitrogen). The following sequences were obtained from Life Technologies ...
-
bioRxiv - Cell Biology 2019Quote: MOVAS-1 cells were transfected with 15 nM siRNA against Thymosin β4 (s201860, Thermo Scientific) or control siRNA (Silencer Select negative control ...
-
bioRxiv - Genomics 2021Quote: H295R cells (2.5M) cultured in complete media were electroporated with 10 uM siRNA (Thermo Fisher Scientific - see supplement for catalog numbers ...
-
bioRxiv - Cell Biology 2019Quote: ... Scrambled control and selected siRNA were purchased from Dharmacon Ontarget plus SMARTpool or from Invitrogen: Scrambled ...
-
bioRxiv - Cancer Biology 2020Quote: ... MDA-MB-231 cells were transfected with control or Il11 siRNAs using Lipofectamine 2000 (Invitrogen) at a final concentration of 50 nM ...
-
bioRxiv - Systems Biology 2020Quote: ... tetracycline-induced cells were subjected to Silencer Select siRNA s20118 transfection (Ambion, catalog no. 4392421). Scrambled Silencer Select Negative Control siRNA (Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... 25 nM of aptamer-siRNA chimeras were complexed with Lipofectamine 2000 reagent (Thermo Fisher, L3000001) in Opti-MEM Media (Thermo Fisher ...
-
bioRxiv - Neuroscience 2021Quote: ... N2a cells were transiently transfected with 10 nM specific siRNA with Lipofectamine RNAiMax (ThermoFisher Scientific) and analyzed after 72 h ...
-
bioRxiv - Cancer Biology 2020Quote: ... siRNA was transfected at a concentration of 8 pmol cm-2 using Lipofectamine RNAiMAX (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and scrambled Silencer Select control siRNA (GUACCAAUUCGUAAGUGUUTT; AACACUUACGAAUUGGUACTT) were transfected using Lipofectamine RNAiMAX (ThermoFisher, 13778100) according to the manufacturer’s specifications ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cells were transfected at a 30 nM siRNA concentration using the Lipofectamine RNAiMax reagent (Invitrogen) per the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2019Quote: ... Gene silencing was performed using siRNA oligonucleotides and Lipofectamine RNAiMax reagent (13778150, Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2021Quote: ... Hepatocytes were transfected with targeting and non-targeting siRNAs using Lipofectamine RNAiMax reagent (ThermoFisher Scientific) as the transfection reagent following manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... HK2 cells were transfected with siRNA for 72 h using Lipofectamine RNAiMax (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: Transfection of A549 cells with siRNAs or plasmids was carried out using Lipofectamine 2000 (Invitrogen) lipofection reagent according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The control (scramble) and human DIMT1 siRNA (Cat# 4392420 and 4392421) were from Thermo Scientific, (Rockford ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfection of siRNA was performed as described previously40 either with Lipofectamine RNAiMAX (Invitrogen, Cat# 13778075) or Amaxa cell line nucleofection kit V (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... Neuro2a cells were transfected with each siRNA for 5 h using Lipofectamine RNAiMAX (Life Technologies) and further incubated for 24-48 h.
-
bioRxiv - Cell Biology 2021Quote: ... or a non-specific siRNA control at 25 nM concentration using lipofectamine RNAiMax (Life Technologies). Duplexes were removed after 6 h and replaced with osteoclast differentiation medium.
-
bioRxiv - Biochemistry 2022Quote: ... Select Pre-designed siRNA for human cardiolipin synthase-1 (CLS) were obtained from Life Technologies Inc ...
-
bioRxiv - Biochemistry 2022Quote: ... 10 μl of 5 μM siRNA was diluted into 250 μl of Opti-MEM (Gibco) and 10 μl of Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with Kif18A Silencer Select siRNA (4390825, Ambion, Thermo Fisher Scientific, MA, USA). For depletion of endogenous PRC1 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were transfected with Kif18A Silencer Select siRNA (4390825, Ambion, Thermo Fisher Scientific, MA, USA). For depletion of endogenous PRC1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Silencer Select siRNAs (Negative control no. 2 – 4390846; TMEM11 - s16855; BNIP3 – s2060; BNIP3L s2063; ThermoFisher) were used for all treatments
-
bioRxiv - Microbiology 2020Quote: ... Cells were then transfected with siRNA (10nM final concentration) using Lipofectamin RNAi Max reagent (Invitrogen) as follows ...
-
bioRxiv - Physiology 2020Quote: ... SiRNAs and RNAiMAX transfection reagent were separately mixed with reduced serum media (Opti- MEM, Gibco). The control or Reverbα/β SiRNA was then added to each well and mixed with an equal quantity of RNAiMAX and then incubated for 5 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2020Quote: ... three non-overlapping siRNA oligos were transfected using Lipofectamine RNAiMAX transfection reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: siRNA was reverse transfected to cells with Lipofectamine RNAiMAX reagent following the standard protocol (Invitrogen). Briefly ...
-
bioRxiv - Cell Biology 2022Quote: Control siRNA against Luciferase (siLuc) was custom ordered from Life technologies (sense: 5’-uaugcaguugcucuccagcdtdt-3’). Individual or pooled siRNAs against other targets were ordered from Horizon Discovery (Dharmacon) ...
-
bioRxiv - Genetics 2022Quote: ... siRNAs were incubated for 20 minutes at room temperature with RNAiMAX Lipofectamine transfection reagent (ThermoFisher) in Opti-MEM reduced serum media (ThermoFisher ...
-
bioRxiv - Cancer Biology 2022Quote: ... The siKEAP1 (4392420; Assay ID: s18981) and negative control siRNA (4390843) were obtained from Ambion™.
-
bioRxiv - Genetics 2022Quote: ... siRNA assays in DMEM were conducted using 2 ml of DMEM (Thermo Fisher # 11966-025) supplemented with 10 mM (low glucose ...
-
bioRxiv - Cell Biology 2020Quote: ... GCP5 and GCP6 (resistant to siRNA) were expressed from pCDNA5/FRT/TO (Invitrogen, Carlsbad, CA). Internal deletions of GCP6 were constructed using the Gibson kit (NEB ...
-
bioRxiv - Cell Biology 2019Quote: ... Duplex siRNA were incubated for 20 minutes at room temperature with RNAiMAX transfection reagent (ThermoFisher) in Opti-MEM reduced serum media (ThermoFisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were transfected with 3 ng of siRNA per well using RNAiMAX lipofectamine (ThermoFisher, 13778150). After 48 hours ...
-
bioRxiv - Microbiology 2019Quote: Transfection of siRNAs into MA104 cells was performed with Oligofectamine reagent (Invitrogen, Carlsbad, CA, USA) in 48-well plates using a reverse transfection method as described previously (88) ...