Labshake search
Citations for Thermo Fisher :
1801 - 1850 of 10000+ citations for 6 Chloro N 5 ethoxy 1H pyrazol 3 yl 3 nitropyridin 2 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... 1% CTS N-2 supplement (Gibco; Thermo Fisher Scientific), 0.5% GlutaMAX (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: ... antibodies targeting the SARS-CoV-2 nucleoprotein (N) (ThermoFisher Scientific ...
-
A critical role for heme synthesis and succinate in the regulation of pluripotent states transitionsbioRxiv - Developmental Biology 2022Quote: ... supplemented with 1x N-2 Supplement (Gibco, 17502-048), 1x B-27 Supplement (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% N-2 Supplement (Thermo Scientific cat#17502-048), 1% B-27 Supplement (Thermo Scientific cat#17504044) ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 mL of N-2 Supplement (Gibco®, 17502), 1 mL of fetal bovine serum (ATCC ...
-
bioRxiv - Bioengineering 2022Quote: ... in N-methyl-2-pyrrolidone (NMP) (>99%, Fisher Scientific), after freebasing when necessary.
-
bioRxiv - Zoology 2022Quote: ... 2 % N-dodecyl-β-D-maltoside (Thermo Fisher scientific), 1% Igepal CA-630 (Sigma) ...
-
bioRxiv - Neuroscience 2022Quote: ... supplemented with N-2 (1:100, Gibco, #17502-048), B-27 (1:50 ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1X N-2 MAX Supplement (ThermoFisher, 17502048), 1X GlutaMAX Supplement (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 % N-2 supplement (#17502048, Thermo Fisher Scientific, USA), 650 µg/mL creatine monohydrate (#C3630 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 mL N-2 Supplement (100X, cat. 17502048, Gibco), 100 μL laminin (1 mg/mL ...
-
bioRxiv - Systems Biology 2022Quote: ... Cytokines including: 1X N-2 (Thermo Fisher Scientific #17502048), 10 ng/ml Neuregulin ...
-
bioRxiv - Developmental Biology 2023Quote: ... and then supplemented with 0.5% N-2 Supplement (Gibco), 1% B-27 Supplement (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... N-2 supplement (1×, Thermo Fisher Scientific, Cat 17502048), B-27 supplement (1× ...
-
bioRxiv - Cancer Biology 2023Quote: ... minus vitamin A N-2 Supplement (100X) (Thermo Fisher), 100 U/mL penicillin-streptomycin (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... N-2 supplement (1×, Thermo Fisher Scientific, Cat 17502048), B-27 supplement (1× ...
-
bioRxiv - Biophysics 2024Quote: ... 1% (vol/vol) N-2 supplement (Gibco, 17502-048), 55 nM hydrocortisone (Sigma-Aldrich ...
-
bioRxiv - Genetics 2023Quote: ... 0.5X N-2 Supplement (100X) (17502-048, Thermo Scientific), 1X PEN/STREP 100X (15-140-122 ...
-
bioRxiv - Neuroscience 2024Quote: ... 1% N-2 Supplement (Thermo Scientific, cat. no. 17502048), 2% HyClone™ Fetal Bovine Serum (ThermoFisher Scientific SH3008803IR) ...
-
bioRxiv - Immunology 2024Quote: ... 5×10-5 M 2-mercaptoethanol (Gibco) and 50µg/mL Gentamicin (Lonza ...
-
bioRxiv - Microbiology 2020Quote: ... and probe E_Sarbeco_P1 (5′-FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ-3′) using the TaqPath 1-Step Multiplex Master Mix kit (Applied Biosystems) on a QuantStudio 5 real-time PCR system (Appiled Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... guide RNA for RBPMS2 (sequence 5’-GTCTTGCAGTGAGCTTGATC-3’) was synthesized using the T7 MegaShortScript transcription kit (Thermo Fisher Scientific). We previously described methods 28 to generate a doxycycline - inducible Cas9 line in the WTC-11 iPSC background (Coriell Institute) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 nM biotinylated 685-bp DNA fragment (68% AT; Table S2) coupled to 3 μL M280 streptavidin dynabeads (ThermoFisher) was incubated with 5 nM prey DNA and H-NS in supplemented Filament Buffer at 5–8 μM 6:4 WT H-NS ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.125 μM Oligo-dT30VN (IDT, 5’AGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Developmental Biology 2019Quote: ... chilled on ice for 5 min and electrophoresed in a 3 – 8% Tris-Acetate NuPAGE gel (Novex Life Technologies). Transfer of the proteins onto a nitrocellulose membrane was done in transfer buffer (5% methanol ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were washed 3 times with WB and nuclei were stained for 5 min with Hoechst 33342 (Life Technologies) in WB ...
-
bioRxiv - Bioengineering 2021Quote: ... 3% and 5% weight/volume (w/v) MeHA solutions were prepared in Dulbecco’s phosphate buffered saline (DPBS; ThermoFisher, 14190136) with 0.05% w/v Irgacure 2959 (I2959 ...
-
bioRxiv - Biochemistry 2020Quote: ... The staining solutions contained 5 μM CM-H2DCFDA or 3 μM MitoSOX™ (both Thermo Scientific, MA, Waltham, USA) diluted in HEPES/HSA for the detection of intracellular or mitochondrial ROS ...
-
bioRxiv - Neuroscience 2020Quote: ... the slices were rinsed 3 times in PBS and incubated in PBS with DAPI (5 μg/ml, Invitrogen, #D1306) and the following secondary antibodies at 4°C for 24 h ...
-
bioRxiv - Microbiology 2020Quote: ... a DNA fragment comprising the entire coding region of kpfR plus approximately 550 pb of 3’ and 5’ flanking regions (Table S4 in the supplemental material) was inserted on pCR2.1-TOPO vector (Invitrogen) previously cloned with erythromycin-resistance gene ...
-
bioRxiv - Cell Biology 2021Quote: ... and lifted for 3 min at 37°C using 5 mL of TrypLE Express (Invitrogen, Gibco, Cat no. #1260501). The appropriate number of cells were then spun down at 90 x g for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... and lifted for 3 min at 37°C using 5 mL of TrypLE Express (Invitrogen, Gibco, Cat no. #1260501). The appropriate number of cells were then spun down at 90 x g for 10 min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... washed 3 times with PBS 5 min each and mounted on glass slides using Prolong Diamond antifade reagent (Invitrogen). We prepared antibodies in PBS containing 3% BSA ...
-
Molecular architecture determines brain delivery of a transferrin-receptor targeted lysosomal enzymebioRxiv - Neuroscience 2021Quote: ... Sections were then rinsed in 1xPBS/0.05% Tween for 3 rounds of 5 minutes and incubated in DAPI (Invitrogen Molecular Probes D1306 ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3.125 µM Oligo-dT30VN (IDT, 5’AAGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Neuroscience 2021Quote: ... slides were washed in 3×5’ PBS and incubated in goat-α-rabbit-555 (1:1000, Life Technologies, A21207) in PBS for 90’ ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were washed in 0.1 M TB (3 ×5 minutes) and then incubated in goat anti-chicken Alexa 488 (1:1000, #A11039, Invitrogen), goat anti-rabbit Alexa 568 (1:500 to 1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Red blood cells were removed by treatment with 3-5 mL of ACK lysis buffer (Gibco, Cat. No. A1049201) and a subsequent washing step in RPMI 1640 with 10% FBS ...
-
bioRxiv - Bioengineering 2019Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid;D3823, Thermo Fisher Scientific), was added to the culture medium for a duration of 60 min and pumped through the media systems at 80 µl/h via positive pressure provided by a syringe pump ...
-
bioRxiv - Cell Biology 2020Quote: ... These duplex reactions were run in triplicate (3 wells) on a QuantStudio 5 Real-Time PCR System (Thermo Fisher). One of two duplex assay pairings were used for each experiment ...
-
bioRxiv - Pathology 2020Quote: ... reverse primer 5’-cgaactCCG AGT TTA TAC TGC CCA GTT CG-3’ with FAM-labeled LUX (Cat. no19450335, Invitrogen). The mouse Vascular Endothelial Growth Factor assay ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Genetics 2020Quote: ... Samples (5 μL each) were loaded into wells of a NuPAGE Tris-acetate 3 – 8% polyacrylamide gel (ThermoFisher Scientific) and electrophoresed for 60 min at 15 volts/cm ...
-
Molecular architecture determines brain delivery of a transferrin-receptor targeted lysosomal enzymebioRxiv - Neuroscience 2021Quote: ... Sections were rinsed in 1xPBS/0.05% Tween for 3 rounds of 5 minutes followed by incubation in secondary antibody (Invitrogen: Goat anti-rat Alexa Fluor 555 ...
-
bioRxiv - Cancer Biology 2021Quote: ... LDHC expression was quantified by specific 5′FAM-3′MGB Taqman gene expression primer/probe sets (Hs00255650_m1, Applied Biosystems). MAP1B expression was quantified using primers for SYBR-based qPCR (F ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Il36A_rev (5′-CAGTTCTTGGGTCAGAATGAGTG-3′) and subsequent cloning into pJET1.2/blunt vector as described by the manufacturer (ThermoFisher Scientific). The DNA fragment encoding mouse C/EBPβ residues 221–296 (bZIP domain ...
-
bioRxiv - Genomics 2021Quote: ... 0.5μM oligo-dT (IDT; 100uM 5′-biotin-ACGAGCATCAGCAGCATACGA-T30VN-3′) and 0.5mM dNTPs/each (Thermo Fisher; 25 mM each) and snap frozen at −80 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The full structure of the NUKU2 transcript was determined with 5’ and 3’ RACE using the GeneRacer kit (Invitrogen), and testicle total RNA (Ambion ...
-
bioRxiv - Immunology 2022Quote: ... PBMCs were cultured at 37°C with 5% CO2 for 3 days in RPMI-1640 medium (Thermo Fisher Scientific) supplemented 10% FCS (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 15 minutes at room temperature and then washed 3 times for 5 minutes each with pH 7.4 Phosphate Buffered Saline (PBS) (Gibco). Cells were then simultaneously permeabilized and blocked with a solution of 0.25% Surfact-Amps X-100 (Thermo Scientific ...