Labshake search
Citations for Thermo Fisher :
1801 - 1850 of 10000+ citations for 6 BROMO 2 4 CHLOROPHENYL 3 METHYLQUINOLINE 4 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 20 mM N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid (HEPES, Gibco) and 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2022Quote: ... and 1% HEPES (N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid; Gibco). Wild type SARS-CoV-2 (isolate USA-WA1/2020 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Physiology 2019Quote: ... to obtain images and then stored at 4°C in 5% acetic acid and 10% glycerol solution in a heat-sealable roll stock pouches (Fisher Scientific, #0181226E). Proteins in gels used for Western Blotting were then transferred to polyvinylidene difluoride membranes (Whatman) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lysates were centrifuged for 5 min at 13 000 × g at 4°C and the concentration of protein was measured using a bicinchoninic acid assay (Thermo Fisher Scientific). Protein lysates were fractionated by SDS-PAGE and transferred onto PVDF membranes ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were then spun down at 14,000 rpm at 4°C for 20 min and quantified using a bicinchoninic acid assay (Thermo Fisher Scientific, 23227). Protein lysates of 10–20 μg were added in with DTT (1 µL ...
-
bioRxiv - Biochemistry 2021Quote: ... Cell debris was removed by centrifugation at 60,000g for 30 min at 4 °C and the supernatant was incubated with nickel-nitrilotriacetic acid (Ni-NTA) resin (HisPur Ni-NTA Resin; Thermo Fisher Scientific) for 1 h at 4 °C ...
-
bioRxiv - Immunology 2020Quote: ... for 90min effective gradient with 4-35% 0.1% formic acid in ACN on an Ultimate 3000 Nano liquid chromatography instrument (Thermo Scientific, Waltham, MA). The separated peptides flew to an Orbitrap Q-Exactive HF mass spectrometer (Thermo Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... Cell debris was cleared by centrifugation at 1000×g for 15 min at 4°C and protein concentration was determined by bicinchoninic acid (BCA) assay (ThermoFisher Scientific #23225). Protein lysates were resolved on Bolt™ 4-12% Bis-Tris Plus gels (ThermoFisher Scientific #NW04125BOX ...
-
bioRxiv - Biochemistry 2023Quote: ... Lysates were centrifuged at 14,000xg for 15 minutes at 4°C and protein concentrations were determined using a standard Pierce™ bicinchoninic acid (BCA) assay (ThermoFisher, 23225). Lysate (30 µg ...
-
bioRxiv - Neuroscience 2024Quote: ... Brain extracts were clarified by centrifugation at 1,500x g for 5 min at 4 °C and then protein concentrations in the supernatant were determined using the bicinchoninic acid (BCA) assay (ThermoFisher Scientific #23227). Detergent-extracted brain homogenates were diluted to a concentration of 5 mg/mL in 1X detergent buffer and then incubated on ice for 20 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Extracts were then centrifuged at 10,000g for 10 min at 4°C and the protein concentration of the soluble fraction determined using the Bicinchoninic Acid (BCA) Assay (Thermo Fisher Scientific). Samples were denatured in 4X Laemmli sample buffer (BioRad Laboratories ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Immunology 2021Quote: ... mixed (1:1 in volume) with Fluo 4 dye (Fluo 4 Direct Calcium Assay Kit, ThermoFisher Scientific) and incubated at 37°C for 30 minutes ...
-
bioRxiv - Developmental Biology 2022Quote: ... Then day 4 aggregates containing hPGCLCs were transferred onto Nunc™ 4-Well Dishes (Thermo Fisher Scientific) containing 1× Protein Label solution ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were fixed for 30 minutes at 4°C with 4% paraformaldehyde in PBS (Thermo Fisher Scientific), briefly washed three times ...
-
bioRxiv - Genomics 2022Quote: Total RNA was extracted separately from testes (n = 4) and ovary (n = 4) tissues using TRIzol (Invitrogen). For each sample ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein samples were separated on a 4-12% NuPAGE 4-12% Bis-Tris protein gels (Thermo Scientific) or 12% Bis-Tris protein gel (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Protein samples were separated on a 4-12% NuPAGE 4-12% Bis-Tris protein gels (Thermo Scientific) for 1 h at 170 V in 1× NuPAGE MOPS SDS running buffer (Thermo Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were loaded into 4-20% Tris-Glycine gel (Invitrogen Novex WedgeWell 4 to 20%, Tris-Glycine) and run at 150 V for 60 min ...
-
bioRxiv - Neuroscience 2024Quote: ... the heads were dissected and fixed overnight at 4°C using 4% paraformaldehyde (Thermofisher, Cat#: J61899-AP). After several washes the heads were incubated in 20% Sucrose (Invitrogen ...
-
bioRxiv - Genomics 2024Quote: ... the cells were loaded with the calcium indicator Fluo-4 (Fluo-4 NW Calcium Assay Kit, Invitrogen) and 500 nM SiR-tubulin Kit (Cytoskeleton ...
-
bioRxiv - Developmental Biology 2024Quote: 4×10^4 hESCs were seeded on 0.5 μg/cm2 Vitronectin-coated 12-well plate (Gibco, A14700) in Nutristem hPSC XF medium (Biological Industries ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Microbiology 2021Quote: ... 10 mM Laurdan (6-Dodecanoyl-2-Dimethylaminonapthalene, Invitrogen) stock solution was prepared in 100% dimethylformamide (DMF ...
-
bioRxiv - Bioengineering 2022Quote: ... 6-diamidino-2-phenylindole (Thermo Fisher Scientific, D1306) for 45 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... 6-Diamidine-2’-phenylindole dihydrochloride (DAPI, Molecular Probes).
-
bioRxiv - Microbiology 2020Quote: ... 6 diamidino-2-phenylindole (DAPI) (ThermoFisher scientific, 10116287) and mounted with Fluoromount-G (Cambridge Bioscience) ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidine-2′-phenylindole dihydrochloride (Thermo Fisher Scientific) was added for nuclear counterstaining ...
-
bioRxiv - Bioengineering 2022Quote: ... 2-6 mL (Thermo Scientific, catalog no. 88516), and the final protein concentration was measured via A280 absorbance.
-
bioRxiv - Neuroscience 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with FluorSave (Calbiochem).
-
bioRxiv - Microbiology 2020Quote: ... 6-diamidino-2-phenylindole dihydrochloride (DAPI, Thermofisher Scientific). The mountant was allowed to cure overnight and coverslips were analysed on an Olympus FV3000 confocal microscope.
-
bioRxiv - Cell Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:10000) and then washed before mounting with a FluorSaveTM reagent (Merck-Millipore).
-
bioRxiv - Pathology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI) (Life Technologies, USA). Samples were visualized with a fluorescence microscope (Olympus ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 6 mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081) ...
-
bioRxiv - Microbiology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) at 37 °C for 10 min ...
-
bioRxiv - Immunology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (Life Technologies, 62248) was used to eliminate dead cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific). IHC and IF stained slides were imaged using the Olympus BX53F epifluorescence microscope (Center Valley ...
-
bioRxiv - Cell Biology 2023Quote: ... 6 diamidino-2-phenylindole (DAPI; ThermoFisher Scientific, 10,116,287) and mounted on slides with Fluoromount-G from Southern biotech (ThermoFisher Scientific ...
-
Polarized Mechanosensitive Signaling Domains Protect Arterial Endothelial Cells Against InflammationbioRxiv - Cell Biology 2023Quote: ... Laurdan dye (6- Dodecanoyl-2-Dimethylaminonaphthalene) (Invitrogen #D250) was applied at 10 μM to cell monolayers and incubated 30 min at 37°C then washed and imaged in 1X HBSS ...
-
bioRxiv - Biophysics 2023Quote: ... and 6-dodecanoyl-2-dimethylaminonaphthalene (LAURDAN) from Thermofisher Scientific (USA) ...
-
bioRxiv - Immunology 2023Quote: ... 2-6 mL (Thermo Fisher Scientific/ Pierce, 88521) Pierce™ Protein Concentrators PES ...
-
bioRxiv - Immunology 2023Quote: ... 2– 6 mL (Thermo Fisher Scientific/ Pierce, 88538). Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific/Pierce ...
-
bioRxiv - Bioengineering 2023Quote: ... 6 mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 6 mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 6 mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081) ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-CD11a (1:50, IBL-6/2, Invitrogen), and FITC anti-PD-1 (1:50 ...
-
bioRxiv - Cell Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (Life Technologies #D3571) for 10 min ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 uM FluoZin-3 AM (Invitrogen) was add to dishes to stain cells for 1 hour and then was washed twice with PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... the samples were reconstituted in 6 uL 0.1% formic acid (FA) 0.05% heptafluorobutyric acid (HFBA) (Thermo Fisher Scientific, cat. 25003).