Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 10000+ citations for rno mir 542 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... and the StepOnePlus™ Real-Time PCR System (Applied Biosystems). After normalization to GAPDH levels ...
-
bioRxiv - Neuroscience 2022Quote: ... on a 7500 Fast Real-Time PCR system (Applied Biosystems). The Taqman probes used in this study are the following ...
-
bioRxiv - Immunology 2022Quote: ... based real time PCR reaction in Quantstudio 3 (Applied Biosystems) using the Standard curve with Melt protocol.
-
bioRxiv - Developmental Biology 2022Quote: ... and a StepOnePlus™ Real-Time PCR System (Applied Biosystems). The gene expression levels were examined through calculation of ΔCt (on log2 scale ...
-
bioRxiv - Cancer Biology 2022Quote: ... with a StepOnePlus™ Real-Time PCR System (Thermofisher Scientific). The thermal cycling parameters followed PCR amplification conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... in an ABI 7900HT Real-Time PCR System (Applied Biosystems). We cycled samples at 95 °C for 10 min and then 40 cycles at 95 °C for 15 s and 60 °C for 1 min ...
-
bioRxiv - Immunology 2022Quote: ... Real-time PCR was performed using SYBR green (Applied Biosystems) and analyzed using the following murine primers sequences ...
-
bioRxiv - Neuroscience 2022Quote: ... in a StepOne Plus real-time PCR machine (Thermo Fisher). The expression of each gene under study was analyzed using pre-designed TaqMan Probes ...
-
bioRxiv - Pathology 2019Quote: ... on QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). PCR primers were designed to specifically amplify genes of interest (table S2) ...
-
bioRxiv - Microbiology 2019Quote: ... with a QuantStudio 5 real time PCR system (Thermo Fisher). The primer-probe sets (dps F – TCTCATCGCCGAACTCAAC ...
-
bioRxiv - Immunology 2020Quote: ... in a 7500 Fast Real-Time PCR system (Applied Biosystems). Primer sets are shown in table S11 in Supplemental Methods.
-
bioRxiv - Cancer Biology 2019Quote: ... and 7900 HT Fast Real-Time PCR System (Thermo Fisher) according to the manufacturers’ instructions ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... or QuantStudio™ 3 Real-Time PCR System (Applied Biosystems) for qPCR analysis ...
-
bioRxiv - Developmental Biology 2019Quote: ... on a StepOne Plus Real-Time PCR System (Applied Biosystems). Reactions were carried out under the following conditions ...
-
bioRxiv - Bioengineering 2019Quote: ... Real-time PCR was performed with a StepOnePlus (Applied Biosystems) instrument using PowerUp SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Genomics 2019Quote: ... on a ViiA 7 Real-Time PCR System (Thermo Fisher). Analysis was performed using the ΔΔCt method (Livak and Schmittgen ...
-
bioRxiv - Developmental Biology 2019Quote: ... on QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). Fragment size distribution and the absence of adapter dimers was checked using Agilent TapeStation 2200 and High Sensitivity D1000 ScreenTape ...
-
bioRxiv - Cancer Biology 2019Quote: ... performed on the 7500 Real-Time PCR System (Applied Biosystems) as previously described72 ...
-
bioRxiv - Immunology 2019Quote: ... on a 7500 Fast Real-Time PCR System (Applied Biosystems). Gene-specific primer sequences were as previously described_ENREF_63 or listed in the Table below ...
-
bioRxiv - Zoology 2020Quote: ... and run on QuantStudio5 Real-Time PCR System (Thermo Scientific). The cycling conditions were as follows ...
-
bioRxiv - Physiology 2020Quote: ... Quantitative real time PCR was performed using TaqMan Probes (Invitrogen) and the TaqMan Gene Expression Master Mix (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... on a QuantStudio 6 Flex Real-Time PCR system (ThermoFisher). Expression data were normalized to RPLP0 ...
-
bioRxiv - Microbiology 2021Quote: ... and analyzed by QuantStudio 5 Real-Time PCR (Thermo Fisher). For RNA-seq analysis ...
-
bioRxiv - Immunology 2020Quote: ... using StepOnePlus™ Real-Time PCR System (Applied Biosystems ™) was performed to screen the samples for presence of Sp ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the 7900HT Fast Real-Time PCR System (Applied Biosystems). The thermocycling protocol was 95°C for 30 s followed by 40 cycles of 95°C for 5 s and 60°C for 30 s.
-
bioRxiv - Molecular Biology 2021Quote: ... and a QuantStudio 3 real-time PCR system (Thermo Fisher). The data were analyzed using the Thermo Fisher Connect Platform ...
-
bioRxiv - Microbiology 2019Quote: ... on a StepOnePlus Real-Time PCR System (Applied Biosystems, USA). The primers specific for mouse or sheep TGF-β ...
-
bioRxiv - Molecular Biology 2020Quote: ... Applied Biosystems 7900HT Fast Real-Time PCR System (Life Technologies) platform was used to run the reactions ...
-
bioRxiv - Cell Biology 2020Quote: ... and the QuantStudio 6 Real-Time PCR System (Applied Biosystems). GAPDH was amplified as a control to normalize the data ...
-
bioRxiv - Immunology 2021Quote: ... using the ViiA-7 Real-Time PCR system (Applied Biosystems), and the expression levels were normalized to GAPDH.
-
bioRxiv - Immunology 2021Quote: ... measured using a StepOnePlus Real Time PCR Machine (Applied Biosystems). Expression was quantified relative to the housekeeping gene Hprt using the ΔCT method ...
-
bioRxiv - Immunology 2020Quote: ... on the QuantStudio7 Flex real-time PCR system (Applied Biosystems). Cycle thresholds (Ct) ...
-
bioRxiv - Cell Biology 2019Quote: ... using the 7500 Fast Real-Time PCR System (Applied Biosystems). Relative expression was evaluated using the ΔΔCt-method and TBP as endogenous control.
-
bioRxiv - Plant Biology 2019Quote: ... in 7300 Real Time PCR machine (Applied Biosystems, MA, USA) as explained before (Markovich et al. ...
-
bioRxiv - Genetics 2020Quote: ... and a QuantStudio 3 Real-Time PCR System (Applied Biosystems). Data are normalized for the expression of the housekeeping gene GUSB ...
-
bioRxiv - Genetics 2020Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). Primers for the gene M04F3.3 / kin-35 were used (Forward CGGTTGAATATTGGTGAGGAGGTT ...
-
bioRxiv - Cell Biology 2021Quote: ... on a StepOnePlus real-time PCR system (Thermo Fisher Scientific). The primers used in this experiment are as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... using a StepOnePlus real-time PCR system (Thermo Fisher Scientific). The relative quantitation of target mRNA levels was performed by using the 2-ΔΔCT method ...
-
bioRxiv - Microbiology 2021Quote: ... and analyzed using StepOnePlus Real-Time PCR system (Life Technologies), using previously described primers31 ...
-
bioRxiv - Molecular Biology 2022Quote: ... in ABI 7500 Real-Time PCR System (Applied Biosystems, USA)
-
bioRxiv - Cancer Biology 2020Quote: ... and run on 7500 Fast Real-Time PCR System (ThermoFisher) with the following standard conditions ...
-
bioRxiv - Biochemistry 2021Quote: ... QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientif). Polymorphisms genotyping for identification of the ACE insertion (I ...
-
bioRxiv - Biochemistry 2021Quote: ... with the StepOnePlus real-time PCR system (Applied Biosystems, USA.). Relative mRNA expression levels were calculated using the comparative cycle threshold method and normalized to GAPDH mRNA levels ...
-
bioRxiv - Immunology 2021Quote: ... on a 7900HT Fast Real-Time PCR system (Thermo Fisher) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... Using the 7500 real-time PCR system from Applied Biosystems, qRT-PCR was performed using the Quantifast SYBR green qRT-PCR kit (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... with the QuantStudio 3 Real-Time PCR System (Applied Biosystems). Relative mRNA expression was determined by the 2-ΔΔCT method (Pfaffl,2001) ...
-
bioRxiv - Physiology 2021Quote: ... in a ViiA 7 Real-Time PCR System (Applied Biosystems) using ViiA 7 Software (Applied Biosystems).
-
bioRxiv - Genetics 2021Quote: ... on the 7900HT Fast Real Time PCR System (Applied Biosystems), following standard procedures ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real time PCR was performed using QuantStudio 6 (ThermoFisher Scientific). Expression of targets was normalized to TBP ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the QuantStudio™ 3 Real-Time PCR System (ThermoFisher). Each target mRNA was quantified in three biological replicates ...