Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 10000+ citations for hsa mir 23b Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2019Quote: ... on QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems). Fragment size distribution and the absence of adapter dimers was checked using Agilent TapeStation 2200 and High Sensitivity D1000 ScreenTape ...
-
bioRxiv - Cancer Biology 2019Quote: ... performed on the 7500 Real-Time PCR System (Applied Biosystems) as previously described72 ...
-
bioRxiv - Immunology 2019Quote: ... on a 7500 Fast Real-Time PCR System (Applied Biosystems). Gene-specific primer sequences were as previously described_ENREF_63 or listed in the Table below ...
-
bioRxiv - Zoology 2020Quote: ... and run on QuantStudio5 Real-Time PCR System (Thermo Scientific). The cycling conditions were as follows ...
-
bioRxiv - Physiology 2020Quote: ... Quantitative real time PCR was performed using TaqMan Probes (Invitrogen) and the TaqMan Gene Expression Master Mix (Applied Biosystems ...
-
bioRxiv - Cancer Biology 2020Quote: ... on a QuantStudio 6 Flex Real-Time PCR system (ThermoFisher). Expression data were normalized to RPLP0 ...
-
bioRxiv - Microbiology 2021Quote: ... and analyzed by QuantStudio 5 Real-Time PCR (Thermo Fisher). For RNA-seq analysis ...
-
bioRxiv - Immunology 2020Quote: ... using StepOnePlus™ Real-Time PCR System (Applied Biosystems ™) was performed to screen the samples for presence of Sp ...
-
bioRxiv - Molecular Biology 2019Quote: ... and the 7900HT Fast Real-Time PCR System (Applied Biosystems). The thermocycling protocol was 95°C for 30 s followed by 40 cycles of 95°C for 5 s and 60°C for 30 s.
-
bioRxiv - Molecular Biology 2021Quote: ... and a QuantStudio 3 real-time PCR system (Thermo Fisher). The data were analyzed using the Thermo Fisher Connect Platform ...
-
bioRxiv - Microbiology 2019Quote: ... on a StepOnePlus Real-Time PCR System (Applied Biosystems, USA). The primers specific for mouse or sheep TGF-β ...
-
bioRxiv - Molecular Biology 2020Quote: ... Applied Biosystems 7900HT Fast Real-Time PCR System (Life Technologies) platform was used to run the reactions ...
-
bioRxiv - Cell Biology 2020Quote: ... and the QuantStudio 6 Real-Time PCR System (Applied Biosystems). GAPDH was amplified as a control to normalize the data ...
-
bioRxiv - Immunology 2021Quote: ... using the ViiA-7 Real-Time PCR system (Applied Biosystems), and the expression levels were normalized to GAPDH.
-
bioRxiv - Immunology 2021Quote: ... measured using a StepOnePlus Real Time PCR Machine (Applied Biosystems). Expression was quantified relative to the housekeeping gene Hprt using the ΔCT method ...
-
bioRxiv - Immunology 2020Quote: ... on the QuantStudio7 Flex real-time PCR system (Applied Biosystems). Cycle thresholds (Ct) ...
-
bioRxiv - Cell Biology 2019Quote: ... using the 7500 Fast Real-Time PCR System (Applied Biosystems). Relative expression was evaluated using the ΔΔCt-method and TBP as endogenous control.
-
bioRxiv - Plant Biology 2019Quote: ... in 7300 Real Time PCR machine (Applied Biosystems, MA, USA) as explained before (Markovich et al. ...
-
bioRxiv - Genetics 2020Quote: ... and a QuantStudio 3 Real-Time PCR System (Applied Biosystems). Data are normalized for the expression of the housekeeping gene GUSB ...
-
bioRxiv - Genetics 2020Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). Primers for the gene M04F3.3 / kin-35 were used (Forward CGGTTGAATATTGGTGAGGAGGTT ...
-
bioRxiv - Cell Biology 2021Quote: ... on a StepOnePlus real-time PCR system (Thermo Fisher Scientific). The primers used in this experiment are as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... using a StepOnePlus real-time PCR system (Thermo Fisher Scientific). The relative quantitation of target mRNA levels was performed by using the 2-ΔΔCT method ...
-
bioRxiv - Microbiology 2021Quote: ... and analyzed using StepOnePlus Real-Time PCR system (Life Technologies), using previously described primers31 ...
-
bioRxiv - Molecular Biology 2022Quote: ... in ABI 7500 Real-Time PCR System (Applied Biosystems, USA)
-
bioRxiv - Cancer Biology 2020Quote: ... and run on 7500 Fast Real-Time PCR System (ThermoFisher) with the following standard conditions ...
-
bioRxiv - Biochemistry 2021Quote: ... QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientif). Polymorphisms genotyping for identification of the ACE insertion (I ...
-
bioRxiv - Biochemistry 2021Quote: ... with the StepOnePlus real-time PCR system (Applied Biosystems, USA.). Relative mRNA expression levels were calculated using the comparative cycle threshold method and normalized to GAPDH mRNA levels ...
-
bioRxiv - Immunology 2021Quote: ... on a 7900HT Fast Real-Time PCR system (Thermo Fisher) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... Using the 7500 real-time PCR system from Applied Biosystems, qRT-PCR was performed using the Quantifast SYBR green qRT-PCR kit (Qiagen ...
-
bioRxiv - Neuroscience 2021Quote: ... with the QuantStudio 3 Real-Time PCR System (Applied Biosystems). Relative mRNA expression was determined by the 2-ΔΔCT method (Pfaffl,2001) ...
-
bioRxiv - Physiology 2021Quote: ... in a ViiA 7 Real-Time PCR System (Applied Biosystems) using ViiA 7 Software (Applied Biosystems).
-
bioRxiv - Genetics 2021Quote: ... on the 7900HT Fast Real Time PCR System (Applied Biosystems), following standard procedures ...
-
bioRxiv - Cancer Biology 2021Quote: ... Real time PCR was performed using QuantStudio 6 (ThermoFisher Scientific). Expression of targets was normalized to TBP ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the QuantStudio™ 3 Real-Time PCR System (ThermoFisher). Each target mRNA was quantified in three biological replicates ...
-
bioRxiv - Microbiology 2020Quote: ... and the StepOnePlus Real Time PCR System (Thermo Fisher Scientific) with forward primer (5’-AAA TTT TGG GGA CCA GGA AC-3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and QuantStudio™ 3 Real-Time PCR System (Applied Biosystems).
-
bioRxiv - Immunology 2020Quote: ... A StepOne ™ Real Time PCR System (Life Technologies, USA) apparatus was used to obtain CT values ...
-
bioRxiv - Immunology 2021Quote: ... using Quant Studio 3 Real-Time PCR system (Applied Biosystems). Glucose-6-phosphate dehydrogenase X-linked (G6PDX ...
-
bioRxiv - Immunology 2021Quote: ... and Applied Biosystems 7500 Real-time PCR Instrument (Life Technologies) using gene-specific primers ...
-
bioRxiv - Neuroscience 2021Quote: ... in the StepOnePlus™ Real Time PCR system (Applied Biosystems). All primers in the study were commercially purchased PrimePCR™ SYBR® Green assay primers (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... using the StepOnePlus real-time PCR system (Applied Biosystems, Canada). All primers were synthesized by Integrated DNA Technologies (Canada) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and an ABI 7900 Real Time PCR System (Applied Biosystems) as described previously (Nakamura et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... on an ABI 7500 Real-Time PCR system (Applied Biosystems). Barly ACTIN was used as an endogenous reference gene to normalize the data ...
-
bioRxiv - Cell Biology 2021Quote: ... in the 7500 Fast Real-Time PCR System (Applied Biosystems). PCR products were amplified using following primer sets ...
-
bioRxiv - Genomics 2021Quote: ... and analyzed by QuantStudio 5 Real-Time PCR (Thermo Fisher).
-
bioRxiv - Genomics 2021Quote: ... on a 7500 Fast Real-Time PCR Machine (Applied Biosystems). Premixed master mixes containing TaqMan primers and probes for each individual gene were purchased from IDT (GAPDH ...
-
bioRxiv - Genetics 2021Quote: ... on a ViiA 7 Real-Time PCR system (Applied Biosystems). Four technical replicates were pipetted on a 384-well plate using the JANUS automated workstation (PerkinElmer) ...
-
bioRxiv - Cell Biology 2020Quote: ... on a ViiA 7 Real-Time PCR System (Applied Biosystems). Primer sequences are listed below.
-
Hydrogen sulfide blocks HIV rebound by maintaining mitochondrial bioenergetics and redox homeostasisbioRxiv - Microbiology 2021Quote: ... using SetupOnePlus™ Real-time PCR system (Applied Biosystems™). DNA isolated from ACH2 cells that contain single copy of HIV per cell was used to obtain standard curve.
-
bioRxiv - Microbiology 2021Quote: ... on a QuantStudio 3 Real-Time PCR Instrument (Applied Biosystems). Replicas were made for each cDNA sample and miaA and miaB levels were normalized to rpoD ...