Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 8194 citations for Recombinant Human BMP5 Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was transiently expressed in Expi293™ (Thermo Fisher Scientific, UK) and protein purified from culture supernatants by immobilised metal affinity followed by a gel filtration in phosphate-buffered saline (PBS ...
-
bioRxiv - Immunology 2020Quote: Recombinant HIV-1 Env gp120 was expressed in Freestyle 293 cells (ThermoFisher) by transient transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... along with 1 unit of RNaseOUT Recombinant RNase Inhibitor (Invitrogen Cat. 10777019) and 1 mM MgCl2 (Thermo Fisher Scientific Cat ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant proteins were expressed using the Expi293 Expression system (ThermoFisher Scientific) and purified with HisTrap FF columns (for polyhistidine-tagged spike proteins ...
-
bioRxiv - Cancer Biology 2021Quote: A recombinant Streptococcus pyogenes Cas9 (GeneArtTM Platinum Cas9 Nuclease, Thermo Fisher Scientific) together with a single-guided RNA (GTAAAGCAGGGCTACATGAG ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 µg/ml mouse recombinant epidermal growth factor (EGF; Thermo Fisher Scientific), 10nM [Leu15]-gastrin I (Merck) ...
-
bioRxiv - Bioengineering 2022Quote: ... putida recombinants was quantified using Trace 1310 Gas Chromatograph (Thermo Fisher Scientific) equipped with ZB-WAX plus column (30 m ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant baculoviruses were prepared in Spodoptera frugiperda (Sf9) cells using Cellfectin (Invitrogen) following the Bac-to-Bac protocol (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: ... recombinant baculoviruses were produced using the ViraPower BacMam Expression System (Thermo Fisher). In brief ...
-
bioRxiv - Immunology 2022Quote: ... The supernatant containing recombinant antibody was incubated with protein A resin (ThermoFisher) overnight at 4 °C ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL of RNaseOUT™ Recombinant RNase Inhibitor (40 units/μL, Invitrogen) and 2 μL of SuperScript™ III RT (200 units/μL ...
-
bioRxiv - Synthetic Biology 2023Quote: All recombinant proteins were produced in Escherichia coli BL21(DE3) pLysS (Invitrogen) transformed with respective plasmids ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 U Uracil N-glycosylase and 0.5 U recombinant Taq polymerase (Invitrogen). Quantitative real-time PCR was run with initial incubation at 25°C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant baculovirus expressing A2AR was prepared using Bac-to-Bac system (Invitrogen). Spodoptera frugiperda 9 (Sf9 ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant H2 was expressed in Invitrogen™ 293FT cells (Thermo Fisher Scientific). 293FT cells were cultured in Gibco™ DMEM (high glucose ...
-
bioRxiv - Immunology 2023Quote: Recombinant antibodies were generated using the Expi293 or Expi293 FUT8−/- system (ThermoFisher) using previously described protocols (60) ...
-
bioRxiv - Neuroscience 2023Quote: ... while for the short we used the Taq DNA Polymerase Recombinant (Invitrogen) kit ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Recombinant protein was extracted using BugBuster Protein Extraction Reagent (Thermo Scientific, USA) and purified using cOmplete His-Tag Purification Resin (Roche ...
-
bioRxiv - Biophysics 2023Quote: Recombinant tubulin was purified by using Bac-to-Bac system (Life Technologies) as described previously18 ...
-
bioRxiv - Biophysics 2023Quote: ... recombinant baculoviruses were prepared using the Bac-to-Bac expression system (Invitrogen). The proteins were expressed in Trichoplusia ni (BTI-Tn5B1–4 ...
-
bioRxiv - Biophysics 2024Quote: ... Recombinant CtNAT10 protein was expressed in both Sf9 cells (ThermoFisher, cat #12659017) and homemade bGroESL cells (See Experimental Model and Subject Details) ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the addition of RNaseOUT recombinant ribonuclease inhibitor (ThermoFisher Scientific 10777-019) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5μL of 40U/μL of RNaseOUT recombinant ribonuclease inhibitor (Invitrogen, #10777-019), and 0.5μL 200 U/μL SuperScript III reverse transcriptase ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 ng/mL recombinant RSPO1 (Thermo Fisher Scientific, cat# 120-38-500UG), and 100 ng/ml recombinant noggin (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cholera Toxin Subunit B (Recombinant) Alexa Fluor 488TM Conjugate (C34775, Invitrogen, Belgium), Tetramethylrhodamine ...
-
bioRxiv - Biochemistry 2024Quote: ... supernatants or serial dilutions of mouse IL2 recombinant protein (Peprotech, ThermoFisher Scientific) (100 μL/well ...
-
bioRxiv - Plant Biology 2020Quote: ... To detect V5-tagged proteins a 1: 5,000 dilution of the primary anti-V5 antibody (Invitrogen, #R96025) and an anti-mouse horseradish peroxidase-conjugated secondary antibody (1:10,000 dilution ...
-
bioRxiv - Biophysics 2021Quote: ... The GFP-tagged and the knockout strains come from the commercial Yeast GFP clone collection (ThermoFisher Scientific). All cultures were grown in YPD medium (1% Yeast Extract ...
-
bioRxiv - Genetics 2021Quote: ... The ORF was Gateway cloned into a C-terminal GFP-tagged Gateway pcDNA-DEST47 vector (ThermoFisher Scientific), sequence verified ...
-
bioRxiv - Molecular Biology 2021Quote: ... HA-tagged hamster SCAP was prepared by subcloning PCR products into the pcDNA5/FRT/TO vector (Invitrogen). DsRed-ER plasmids were purchased from Addgene (#55836) ...
-
bioRxiv - Molecular Biology 2022Quote: GST-tagged bait proteins were purified using Pierce GST Protein Interaction Pull-Down kit (Thermo-Fisher Scientific). To examine recombinant Pin1 phosphorylation ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 μg (otherwise noted) of terminally tagged and unmodified σ1R plasmid was transfected using lipofectamine 2000 (Invitrogen) for HEK 293T Δσ1R cells in a 10 cm plate ...
-
bioRxiv - Neuroscience 2019Quote: ... GFP-Msp300KASH tagged OSN nuclei were pulled down using a Chicken anti-GFP antibody (Invitrogen #PA1-9533) bound to magnetic Dynabeads™ Protein G (Invitrogen #10003D) ...
-
bioRxiv - Microbiology 2019Quote: ... coli MG1655 cells expressing tagged HupA-GFP with 2 µg/ml of FM4-64 dye (Invitrogen, USA) and incubating for 5 min at 37°C with shaking at 180 rpm ...
-
bioRxiv - Biochemistry 2019Quote: His-tagged SIVsmm Nef constructs were expressed in BL21 (DE3) star cells (Life technologies, Grand Island, NY), and induced with 0.3 mM IPTG at 25 °C overnight ...
-
bioRxiv - Cancer Biology 2019Quote: ... EdU was tagged with Alexa Fluor 647 picolyl azide through click reaction (Click-iT chemistry, ThermoFisher, C10640). The cells were blocked with blocking buffer at least overnight at 4°C ...
-
bioRxiv - Biochemistry 2021Quote: ... Pierce anti-HA beads for immunoprecipitation of HA-tagged GAPDH was purchased from Thermo Fisher (Cat. # 88836) Rabbit polyclonal antibody (Cat ...
-
bioRxiv - Neuroscience 2021Quote: ... Epitope-tagged proteins were eluted from beads by boiling for 5 min in LDS sample buffer (ThermoFisher). Anti-D-cysteine immunoprecipitates were eluted by incubating beads in 1 mM D-cys in TBS for 30 min at room temperature ...
-
bioRxiv - Physiology 2021Quote: ... incubated with different primary Abs and revealed by appropriate Alexa-Fluor-tagged secondary Abs (Thermo Fisher Scientific). Cells were analyzed by using a Nikon Ti Eclipse inverted microscope with A1 scanning confocal microscope at the Confocal and Specialized Microscopy Shared Resource (CSMSR) ...
-
bioRxiv - Plant Biology 2021Quote: ... Purified His-tagged proteins were resolved by SDS-PAGE (NuPAGE 4-12% Bis-Tris Protein Gels, Invitrogen) and gels were stained with Quick Coomassie Stain (Generon) ...
-
bioRxiv - Cell Biology 2021Quote: ... incubated with different primary Abs and revealed by appropriate Alexa-Fluor-tagged secondary Abs (Thermo Fisher Scientific). Slides were mounted in Fluoromount-G (Southernbiotech ...
-
bioRxiv - Neuroscience 2020Quote: ... The fluorescent-tagged secondary antibodies Alexa Fluor 488 and Alexa Fluor 555 (1:500, Thermo Fisher Scientific) were used for detection ...
-
bioRxiv - Cell Biology 2021Quote: cDNAs in pENTR or pDONR were transferred into tagged mammalian expression vectors using Gateway® recombination (Invitrogen): pCAG-DEST-EGFP ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were transfected with 200 ng of Flag-tagged FOXQ1 using Lipofectamine 2000 (Thermo Fisher, Waltham, USA). After 24 hours ...
-
bioRxiv - Microbiology 2022Quote: ... His-tagged proteins were purified using HisPur™ Ni-NTA resin (Thermo Fisher Scientific Cat. Nr. 88222) according to manufacturer’s instructions (batch protocol) ...
-
bioRxiv - Microbiology 2020Quote: ... His tagged proteins were isolated from the supernatant using Dynabeads™ His-Tag Isolation and Pulldown (Invitrogen) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Species-specific secondary antibodies tagged with Alexa Fluor corresponding to 568 nm emission spectra (1:1,000, Thermofisher) was used for immunofluorescence ...
-
bioRxiv - Microbiology 2022Quote: ... HNRNPUL1 and MECR were recombined into V5-tagged mammalian expression constructs by Gateway cloning into pcDNA6.2 (Invitrogen) and pLX304 (Addgene 25890) ...
-
bioRxiv - Microbiology 2021Quote: ... The His-tagged proteins were blotted using anti-6x His tag HRP-conjugated monoclonal antibody (Invitrogen, USA) and detected using Clarity Western ECL Substrate (Bio-Rad ...
-
bioRxiv - Molecular Biology 2021Quote: ... Flag tagged proteins were immunoprecipitated from 2-3mg cellular extracts with Pierce Anti-DYKDDDDK Magnetic Agarose (Invitrogen). Beads were washed 5x with 1ml IP lysis buffer end eluted with 50µl 1xLaemmli buffer ...