Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 6840 citations for H D Glu amc oh since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
A chlorzoxazone-baclofen combination improves cerebellar impairment in spinocerebellar ataxia type 1bioRxiv - Neuroscience 2020Quote: ... Alexa Fluor 594 goat anti-rabbit IgG (H+L) (1:200; Invitrogen, Cat. #A11012), Alexa Fluor 594 goat anti-mouse IgG (H+L ...
-
A chlorzoxazone-baclofen combination improves cerebellar impairment in spinocerebellar ataxia type 1bioRxiv - Neuroscience 2020Quote: ... Alexa Fluor 488 goat anti-rabbit IgG (H+L) (1:200; Invitrogen, Cat. #A11034), Alexa Fluor 594 goat anti-rabbit IgG (H+L ...
-
bioRxiv - Cell Biology 2022Quote: ... Silencing was performed for 72–96 h using Lipofectamine RNAiMAX (Thermo Fisher Scientific 13778150) or INTERFERrin (Polyplus 409-10 ...
-
bioRxiv - Cancer Biology 2022Quote: ... followed by cDNA synthesis using the RevertAid H Minus Reverse Transcriptase (Thermo Fisher Scientific). RT-qPCR was performed using SYBR Fast qPCR Master Mix (Kapa Biosystems ...
-
bioRxiv - Biophysics 2020Quote: ... Secondary antibodies (AlexaFluor 488 goat anti-mouse IgG (H+L) (1:150, A28175 ThermoFisher), AlexaFluor 568 goat anti-rabbit IgG (H+L ...
-
bioRxiv - Biophysics 2020Quote: ... and Alexa Fluor 633 goat anti-chicken IgG (H+L) 2 mg/ml (Invitrogen) in PBS with 10% FBS and 0.1% saponin ...
-
bioRxiv - Molecular Biology 2020Quote: ... hybridization was performed at 35°C for 12 h in UltraHyb-Oligo buffer (Ambion) containing desired probes (Pseudo_GlyGCC_10 – TACCACTGAACCACCAATGC ...
-
bioRxiv - Genomics 2020Quote: ... buffer and enzyme from the Maxima H Minus Reverse Transcriptase kit (Thermo Fisher Scientific), as well as strand switching primer (SSP ...
-
bioRxiv - Bioengineering 2021Quote: ... and Alexa 488 donkey anti-mouse IgG (H+L; Invitrogen, A-21202, 1:2000), sequentially ...
-
bioRxiv - Immunology 2020Quote: ... with Goat Anti-rabbit IgG H&L Alexa Fluor® 647 (A-21245, Invitrogen) (dilution 1:200) ...
-
bioRxiv - Cell Biology 2020Quote: ... closed packed barcoding beads in RNA bead buffer (1x Maxima H-RT Buffer (ThermoFisher), 2% (v/v ...
-
bioRxiv - Plant Biology 2021Quote: Nigericin free acid: a K+/H+ ionophore (Molecular Probes/Thermo Fisher cat. #: N-1495); a 5 mg/mL stock in EtOH (J.T ...
-
bioRxiv - Plant Biology 2021Quote: Nigericin free acid: a K+/H+ ionophore (Molecular Probes/Thermo Fisher cat. #: N-1495); a 5 mg/mL stock in EtOH (J.T ...
-
bioRxiv - Cell Biology 2021Quote: ... donkey anti-Rabbit IgG (H+L) antibody Alexa Fluor® 594 (all Thermo Fisher), Lotus Tetragonolobus Lectin (LTL ...
-
bioRxiv - Immunology 2021Quote: ... A horseradish peroxidase (HRP) conjugated goat anti-monkey H+L antibody (Invitrogen #PA1-84631) was then added and incubated for 1h before excess Ab was washed out and HRP substrate added ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the coverslips were incubated 1 h with mouse anti–V5 antibody (Invitrogen, 1:500) and 1 h with the secondary antibody which was donkey anti–mouse coupled to Alexa Fluor 488 (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... Goat anti-Rabbit IgG (H+L) Cross-Adsorbed unconjugated secondary antibody (Invitrogen 31212, RRID:AB_228335) and Goat anti-Chicken IgY (H+L ...
-
bioRxiv - Physiology 2020Quote: ... Cells were transfected 24 h after cell seeding using Lipofectamine 3000 (Invitrogen, CA, USA) To study the subcellular localization of Nav1.5 full-length channels in the homozygous state ...
-
bioRxiv - Cell Biology 2021Quote: ... and Goat anti-Rabbit IgG (H+L) HRP- conjugate (1:10,000, G21234 - Molecular Probes). The signals were developed using ECL Prime Western Blotting System (#GERPN2232 ...
-
bioRxiv - Cell Biology 2020Quote: ... and anti-IgG(H+L)-Alexa488 (Thermo Fisher Scientific, A-11008 and A-32723) were used in immunofluorescence.
-
bioRxiv - Neuroscience 2021Quote: ... Alexa Fluor 568 goat anti-rabbit IgG (H+L) (Molecular Probes Cat# A-21429); Alexa Fluor 647 goat anti-mouse IgG (H+L ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were transfected with each plasmid for 5 h using Lipofectamine 2000 (Life Technologies) and further incubated for 24-48 h ...
-
bioRxiv - Immunology 2021Quote: Activated (96 h) healthy human T cells were stained for viability using DAPI (ThermoFisher). Cells were isolated based on size using the Influx fluorescence-activated cell sorter (BD Biosciences) ...
-
bioRxiv - Immunology 2020Quote: ... pre-coated with 100ug/ml goat anti-hamster IgG (H+L, Thermo Fisher Scientific) followed by 5ug/ml each anti-CD3 (clone 3C11 ...
-
bioRxiv - Molecular Biology 2021Quote: ... slides were incubated with Alexa Fluor 488 goat anti-human IgG(H+L) (Invitrogen) at 1:500 (in 3% BSA/PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... and goat anti-rabbit IgG(H+L) Alexa Fluor 568 (Thermo Fisher Scientific, A11011), respectively ...
-
bioRxiv - Developmental Biology 2020Quote: ... and incubated 1-2 h in secondary antibodies Alexa-488 and Alexa-647 (ThermoFisher) to label GFP and Fas3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Donkey anti-Rabbit IgG (H+L) Alexa Fluor 488 (Invitrogen, A-21206, 1:1000). Finally ...
-
bioRxiv - Cancer Biology 2022Quote: ... Donkey anti-Rabbit IgG (H+L) Alexa Fluor 488 (Invitrogen, A-21206, 1:1000).
-
bioRxiv - Neuroscience 2023Quote: ... Alexa Fluor 594 goat anti-mouse IgG (H + L; 1:500; A-11005, Invitrogen).
-
bioRxiv - Neuroscience 2023Quote: ... Alexa Fluor 647 goat anti-rabbit IgG (H + L; 1:500; A-21244, Invitrogen), Alexa Fluor 594 goat anti-mouse IgG (H + L ...
-
bioRxiv - Immunology 2022Quote: ... first strand cDNA synthesis was performed using Maxima H Minus Reverse Transcriptase (Thermo Fisher), E3V6NEXT primers (specific primer for each well ...
-
bioRxiv - Immunology 2022Quote: ... incubated with a 1:10,000 dilution goat anti-human IgG (H+L)-HRP (Invitrogen), and washed twice more before detection with ECL (ECL Plus Western Blotting Substrate ...
-
bioRxiv - Synthetic Biology 2023Quote: ... cDNA was synthesized using RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Scientific) and oligo(dT)18 primer ...
-
bioRxiv - Synthetic Biology 2022Quote: ... RNA was converted to cDNA using Maxima H Minus Reverse Transcriptase (Thermo Scientific, EP0751) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... goat anti-Mouse IgG (H+L) Highly Cross-Adsorbed Alexa Fluor 488 (Thermo Fisher Scientific Cat# A-11029 ...
-
bioRxiv - Microbiology 2023Quote: ... NAD(H) intracellular concentrations were normalized by protein content (Qubit Protein Assay Kit - Invitrogen). For membrane potential ...
-
bioRxiv - Biochemistry 2023Quote: ... for 24 h or 10 nM of siRNA and 5 µL of RNAiMAX (Invitrogen) for 48 h ...
-
bioRxiv - Molecular Biology 2023Quote: ... h-) was verified by western blot with an anti-TAP antibody (Thermo Scientific, CAB1001). Prototrophic Cbf12-TAP strains (MP540/MP541 ...
-
bioRxiv - Biophysics 2023Quote: ... Medium was changed 6 h after transfection with regular medium (11995-065; Gibco BRL).
-
bioRxiv - Microbiology 2023Quote: ... for 1 h and washed with PBS (Gibco, Thermo Fisher Scientific, Waltham, MA, USA). CLSM images were recorded with a LSM700 system (Carl Zeiss ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alexa Fluor 647 goat anti-rabbit IgG (H+L) (Invitrogen, cat # A21244, 1:1000), Alexa Fluor 647 goat anti-mouse IgG (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alexa Fluor 555 goat anti-rat IgG (H+L) (Invitrogen, cat # A21434, 1:1000), Alexa Fluor 647 goat anti-rabbit IgG (H+L ...
-
bioRxiv - Developmental Biology 2023Quote: ... Donkey anti-Mouse IgG (H&L) (Alexa fluor 594, catalog no. R37115; Life Technologies). Sections were then washed with PBS and incubated for 10 min with DAPI ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were transfected for 8 h with indicated plasmids in Lipofectamine 3000 (Invitrogen) and then allowed for 24-h recovery from transfection by changing a fresh medium before subsequent experiments.
-
bioRxiv - Molecular Biology 2023Quote: ... and followed by another 2 h incubation with Dynabeads MyOne Streptavidine C1 (62001, ThermoFisher). The beads were washed twice with low and high salt buffers at 37C ...
-
bioRxiv - Plant Biology 2023Quote: ... Thermo Scientific™ Maxima H Minus First Strand cDNA Synthesis Kit (ThermoFisher, Cat. FERK1652) was used for cDNA synthesis ...
-
bioRxiv - Developmental Biology 2023Quote: ... for 1 h at room temperature followed by development in ECL (Thermo Fisher Scientific). ChemiDoc (BioRad ...
-
bioRxiv - Plant Biology 2023Quote: Extracted RNA was converted into cDNA using RevertAid H Minus Reverse Transcriptase (Thermo Scientific). For qPCR 20ng of cDNA was used per 5µl reaction ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... for 1 h at room temperature followed by development in ECL (Thermo Fisher Scientific) or Clarity ECL (BioRad) ...