Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 10000+ citations for 7 Quinolinecarboxylicacid 1 2 3 4 tetrahydro 1 methyl 2 oxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 1-2 drops of ProLong Gold Antifade Mountant (cat# P36930, Molecular Probes, Eugene, OR) were added ...
-
bioRxiv - Immunology 2023Quote: ... Luc-Screen™ Extended-Glow Luciferase buffers 1 and 2 (ThermoFisher, Cat No. T1035) used according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... and an ICAM1 exon 2 (Ig domain 1)-targeting TrueGuide sgRNA (Invitrogen; sequence: CCACAGTTCTCAAAGCACAG) according to the manufacturer’s U2OS protocol ...
-
bioRxiv - Biophysics 2023Quote: ... 1 mM TCEP (tris(2-carboxyethyl)phosphine (TCEP) and EDTA-free protease inhibitors (ThermoFisher). Cells were lysed by sonication and the cell debris pelleted at 50000 x g and 4 °C for 30 min ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µL 1 M DTT and 27.5 µL of T4 Polynucleotide Kinase (Thermo Scientific) were added to the annealed oligonucleotides and the reaction was incubated for 2 h at 37 °C ...
-
bioRxiv - Cancer Biology 2022Quote: ... The microwells were in lysis buffer (1% 2-mercaptoethanol (Fisher Scientific, cat# BP176-100), 99% Buffer TCL (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... viruses were mixed 1:2 with PBS-washed sheep blood (Fisher Scientific, MA, USA) supplemented with 5 mM ATP ...
-
bioRxiv - Physiology 2023Quote: Isolated cardiomyocytes were loaded with 1 μM Fura-2 AM (Invitrogen, Carlsbad, California, USA) at room temperature for 15 min and then washed for 15 additional min with an external Ringer solution containing (in mmol/L) ...
-
bioRxiv - Immunology 2023Quote: ... Lymphocytes were plated at 1-2 × 106 cells/mL in RPMI: RPMI 1640 (Gibco) supplemented with 15% FCS ...
-
bioRxiv - Neuroscience 2023Quote: ... for 2 h and Alexa Fluor 594-conjugated streptavidin (1:500, Thermo Scientific, S32356) for 1 h at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... Mouse anti-E-cadherin (2 μg/ml, clone HECD-1; Invitrogen, Carlsbad, California, USA) and mouse anti-CX3CL1 (2 μg/ml ...
-
bioRxiv - Developmental Biology 2023Quote: ... and ERCC RNA ExFold RNA Spike-In Mix 1 and 2 (Thermo Fisher Scientific) were added to wild-type and Meioc-null samples ...
-
bioRxiv - Immunology 2023Quote: ... 1.5 mL of enhancer 1 and 0.15 mL of enhancer 2 (Expifectamine kit, Gibco) were added to the cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... and AF647 rat anti-Intercellular adhesion molecule 2 (ICAM2, 1:250, A15452, Thermo Fisher).
-
bioRxiv - Developmental Biology 2023Quote: ... and then incubated in 1 mL crosslinking solution containing 2% formaldehyde (Pierce, ThermoFisher Scientific) (50mM HEPES Buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... and 1% SDS buffer and digested with 2 µL RNAse Cocktail (Thermo Fisher, AM2286) for 4 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... PANC-1 and MIA PaCa-2 cell lines were cultured in DMEM medium (Gibco) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... at 1:1000 dilution in 2× SSC (diluted from 20× SSC, Invitrogen, 15557-044) for 10 min ...
-
bioRxiv - Cell Biology 2023Quote: ... 2% of Horse Serum and 1% of penicillin-streptomycin (Thermo Fisher, Waltham MA, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... 2 mM GlutaMAX and 1 mM sodium pyruvate (both Thermo Fisher Scientific, Waltham, USA) were added to the starting buffer.
-
bioRxiv - Neuroscience 2024Quote: ... 2) Concentrate worms by centrifugation (1 minute, 4000-RPM, Thermo Scientific Sorvall Legend X1R), discard the supernatant ...
-
bioRxiv - Cell Biology 2019Quote: ... 2×2 binning (3.7mm^2 field area)) on the ArrayScan VTI (Thermo Scientific) and analyzed simultaneously for percentage of GFP positive cells using the Target Activation Bioapplication (Thermo Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... total soluble proteins were extracted from 50 mg of plant materials grown as indicated previously with 100 μL 2 x Laemmli buffer supplemented with 1% Phosphatase Inhibitor Cocktail 2 (Thermo Fisher Scientific Inc., 78430). Proteins were denatured for 10 min at 95°C and separated on 10% or 8% SDS-PAGE ...
-
bioRxiv - Neuroscience 2021Quote: ... Pipettes had resistances of 5–7 MΩ when filled with this solution supplemented with Fura-2 (Molecular Probes). Recordings were made using a Multiclamp 700B amplifier (Molecular Devices ...
-
bioRxiv - Microbiology 2020Quote: ... prehybridization was carried out for 2 h at 42°C in 7 mL of prehybridization buffer ULTRAHyb (Ambion). Hybridization was performed overnight at 42°C in the same buffer in the presence of a [γ-32P]-labeled DNA oligonucleotide probe ...
-
bioRxiv - Microbiology 2021Quote: ... Unbound GTP was removed using 2 mL Zeba column with 7 kDa molecular weight cutoff (Thermo Scientific, 89889) and exchanged into 30 mM Tris pH = 7.5 buffer containing 1 mM DTT ...
-
bioRxiv - Microbiology 2023Quote: ... and then primers listed in Supplemental Table 2 on a ViiA 7 real-time PCR system (Applied Biosystems) with the following cycling parameters ...
-
bioRxiv - Developmental Biology 2022Quote: ... Quantitative PCR for pri-let-7 and eft-2 were performed with Absolute Blue SYBR Green (Thermo Scientific) on the CFX63 Real Time System Thermocyclers (Biorad ...
-
bioRxiv - Immunology 2023Quote: ... iGB cells were collected after 6-7 days on iGC culture and were stained with Fura-2 (Invitrogen) at 1μM / ml ...
-
bioRxiv - Biophysics 2023Quote: ... The DTT was removed using a 2 ml ZebaSpin MWCO 7 kD desalting column (Thermo Fisher Scientific, USA). The columns were pre-equilibrated by washing them with 1 ml 10 mM TRIS buffer at pH 7.5 for three consecutive times by spinning them at 1000 G for 2 minutes for each washing step ...
-
bioRxiv - Genomics 2022Quote: ... HPC-7 cells were maintained at density of 2-10 x105/ml in Iscove’s modified Dulbecco’s medium (Invitrogen) supplemented with 50 ng/ml of mouse stem cell factor (Gemini Bio-Products) ...
-
bioRxiv - Biochemistry 2023Quote: ... for 40 min before neutralizing to approximately pH 7 with 2 M Tris (Thermo Fisher Scientific, Waltham, MA) in water ...
-
bioRxiv - Cancer Biology 2021Quote: ... in medium containing active caspase-3/7 detection reagent (ThermoFisher). Chamber slides were mounted on a heated stage within a temperature-controlled chamber maintained at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... cells were stained with CellEvent Caspase-3/7 Green (Invitrogen). The cytotoxicity was assessed by flow cytometry as the percentage of Caspase 3/7+ cells in the target cell population ...
-
bioRxiv - Immunology 2022Quote: ... stained for apoptosis with CellEvent Caspase-3/7 (Thermo Fisher), incubated for additional 30 min ...
-
bioRxiv - Pathology 2022Quote: ... cells were stained for activated caspase 3/7 kit (Invitrogen); 7-amino-actinomycin D (7AAD ...
-
bioRxiv - Cancer Biology 2022Quote: ... CellEvent Caspase-3/7 Green Flow Cytometry Kit (Thermo Fisher) was used to measure fraction of apoptotic cells by flow cytometry (BD LSR Fortessa with HTS sampler) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Invitrogen CellEvent Caspase-3/7 green detection reagent (C10423, ThermoFisher) was used as stated in manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... CellEvent Caspase-3/7 Green ReadyProbes™ Reagent (Invitrogen, R37111) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... a Caspase-3/7 assay kit was used (Invitrogen, C10427). Each tube was brought to a volume of 1 ml staining buffer and 1 μl of CellEvent Caspase-3/7 reagent was added ...
-
bioRxiv - Cancer Biology 2023Quote: ... reagent at a 4:2:3 ratio of sgRNA/overexpression-construct: pVSVG: psPAX2 in Opti-MEM media (Life Technologies, Thermo Fisher Scientific Inc, Waltham, MA). Viral supernatants were collected 48 hours post-transfection and filtered through a 0.45 μm Nalgene syringe filter SFCA (Whatman ...
-
bioRxiv - Microbiology 2020Quote: ... the sections were sequentially incubated with mouse polyclonal antibody to SARS-CoV-2 N protein (1:500 dilution) and HRP-conjugated goat anti-mouse IgG secondary antibody (1:5000 dilution, Invitrogen). The sections were observed under microscope (Olympus ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Regulatory T cells were activated at 1 x 106 cells mL-1 for 2 days in complete XVivo15 supplemented with magnetic Treg Xpander CTS Dynabeads (ThermoFisher) at a 1:1 bead to cell ratio and 500 U mL-1 of IL-2 (UCSF Pharmacy) ...
-
bioRxiv - Neuroscience 2019Quote: ... KSR medium was gradually transitioned in 25% increments to neural medium (N2/B27-Neurobasal medium, 2% B27 supplement, 1% N2 supplement, 1% Glutamax, (ThermoFisher)) over an 11-day period ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells from the previous steps were barcoded by cotransfecting PB-EF1α-Puro-V8.2 library and Super PiggyBac Transposase plasmid (SBI #PB210PA-1) at a 1:10 molar ratio using Lipofectamine 3000 (Thermofisher). Barcoded cells were puromycin-selected for 7 d ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were then incubated for 1 hr with goat anti-rabbit Alexa Fluor 488F(ab’)2 Fragment (1:1000, A11070; Invitrogen) and Alexa Fluor 568 Phallodin (A12380 ...
-
bioRxiv - Microbiology 2021Quote: ... the sections were incubated with house-made mouse anti-SARS-CoV-2 nucleocapsid protein serum (1:5000) and HRP465 conjugated goat anti-mouse IgG secondary antibody (1:5000 dilution, Invitrogen). The lung sections from the vector-transduced mouse were used as negative control ...
-
bioRxiv - Microbiology 2021Quote: ... in 10% FBS for 1-2 hours followed by incubation with secondary goat anti-rabbit AlexaFluor 594 antibody (1:1000, Invitrogen) in 10% FBS for 30 min ...
-
bioRxiv - Bioengineering 2020Quote: ... The cells were passaged at a density of 1:2 to 1:8 after reaching ~80% confluency by detaching with 5 mM EDTA in PBS (Invitrogen 15575-038 diluted in sterile 1X PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Medium was replaced at day 2 with N2B27 medium consisting of 1:1 pre-mixed neurobasal medium (#21103-049) and DMEM/F12 (#21331-020, Gibco), 1% B27 supplement without vitamin A (#12587-010 ...