Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 10000+ citations for 7 Fluoro 4 hydroxy 3 nitroquinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... counted and reseeded in 3 mL A medium (1:3 mix DMEM/F12 (Gibco) and Neurobasal (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2019Quote: 3’-tRNAs biotinylation was adapted from Pierce RNA 3’-End Biotinylation Kit (Thermo Fisher). Deacylated tRNAs were denaturated in 25% DMSO at 85°C for 5 minutes and directly chilled on ice ...
-
bioRxiv - Neuroscience 2019Quote: ... NIM was exchanged for “3:1 medium” containing 3 parts DMEM (Gibco, #10569‒010) per 1 part F12 medium (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μl were sampled on a 3 well Diagnostika slides (X1XER303B) from Thermo scientific for observation on an Zeiss LSM710 confocal microscope equipped with a Plan-Apochromat 63×/1.4 Oil objective and 405 nm and 488 nm lasers ...
-
bioRxiv - Microbiology 2023Quote: ... 3′RNA-seq libraries were analyzed on a Qubit 3 Fluorometer (Thermo Fisher Scientific) and an Agilent 4200 TapeStation System prior to paired- end sequencing using the HiSeq 2500 system (Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... 3 μg DNA and 3 μL Lipofectamine in 300 μl Optimem (Thermofisher Scientific, USA) were used per well containing 700 μl DMEM ...
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mg of solid red DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, Molecular Probes) dissolved in methylene chloride were mixed with 50 mg of tungsten beads (1.3 microns in diameter ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μl of 4 mM resazurin sodium salt (Acros Organics, Belgium), 0.002 U purified Castellaniella defragrans geraniol dehydrogenase ...
-
bioRxiv - Biophysics 2019Quote: Isolated islets were loaded with 4 µM Fluo-4 AM (Invitrogen) for 45min at 37°C in imaging medium (125mM NaCl ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... isolated with Protein A Dynabeads (Invitrogen; 4 h at 4°C), washed thrice with RSB+T ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Genomics 2021Quote: ... 3 mL (Thermo Fisher Scientific) overnight at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific 15557044 ...
-
bioRxiv - Biochemistry 2019Quote: ... 50 × 3 mm (Thermo Scientific). The mobile phase consisted of 100 mM ammonium carbonate (A ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3 mM glutamine (Life Technologies), 10% dialyzed fetal bovine serum (dFBS ...
-
bioRxiv - Developmental Biology 2019Quote: ... and toto-3 (Life Technologies) were used after primary antibody incubation.
-
bioRxiv - Immunology 2021Quote: ... supplemented with 3% FBS (Gibco) and 100 U/mL penicillin-streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved-caspase-3 (9H19L2-Invitrogen); TH (AB152-Merck Millipore) ...
-
bioRxiv - Bioengineering 2020Quote: ... SP-DiOC18(3) (ThermoFisher Scientific) for 20 min ...
-
bioRxiv - Neuroscience 2020Quote: sucrose (Fisher Scientific #S5-3), cellobiose [D-(+)-cellobiose ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 mM NaOH (Fisher Scientific) in neurobasal medium] and centrifugation at 800 × g for 5 min ...
-
bioRxiv - Cell Biology 2021Quote: ... The QuantStudio 3 system (Thermofisher) was used for reactions under the following conditions ...
-
bioRxiv - Systems Biology 2020Quote: ... and 3 μl RNAiMAX (Invitrogen). For every gene ...
-
bioRxiv - Microbiology 2020Quote: ... using a QuantStudio 3 (ThermoFisher). KiCqStart SYBR green primers for qRT-PCR (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... 3) Accutase (Thermo Fisher Scientific) treatment for 15 min (Figure 4E) ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-galectin 3 (ThermoFisher). Membranes were imaged using LI-COR Odyssey IR imager ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 3% sodium bicarbonate (Gibco). A549 (ATCC CCL-185 ...
-
bioRxiv - Cancer Biology 2021Quote: ... YOYO-3 (Thermo Fisher Scientific) was supplemented to the culture to detect cellular death ...
-
bioRxiv - Cell Biology 2022Quote: ... Following 3 PBS (ThermoFisher Scientific) washes ...
-
bioRxiv - Microbiology 2022Quote: ... Quantstudio 3 software (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... IL-18 (Invitrogen, BMS618-3) and TNF-α (BioLegend ...
-
bioRxiv - Developmental Biology 2022Quote: ... or TO-PRO-3 (Invitrogen) for 10 min at RT or O/N at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... 3 mL (Thermo Fisher Scientific) at 4°C overnight ...
-
bioRxiv - Developmental Biology 2022Quote: ... To-Pro-3 (Molecular Probes) or 4’,6-diamidino-2-phenylindole (DAPI ...
-
bioRxiv - Cell Biology 2020Quote: ... A QuantStudio 3 (Applied Biosystems) real-time thermocycler was used with the cycling conditions of 50 °C for 2 minutes ...
-
bioRxiv - Immunology 2022Quote: ... TIM-3 (F38-2E2, Invitrogen), PD-1 (EH12.2H7 ...
-
bioRxiv - Neuroscience 2019Quote: ... 3 micron (Thermofisher Scientific, USA). The mobile phase contained water/methanol (40:60 ...
-
bioRxiv - Developmental Biology 2019Quote: ... Cy-3 (A1051, Molecular probes), Alexa Fluor 647 (A21235 ...
-
bioRxiv - Microbiology 2021Quote: ... 3 µg/ml Puromycin (Gibco) was added 48 hours after transduction before KD analysed via qPCR and western blot if appropriate.
-
bioRxiv - Bioengineering 2020Quote: 3-nitrophenylhydrazine (N02325G, Fisher Scientific), N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide HCl (50-848-678 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 mM Magnesium Chloride (Ambion) and 6 U/ml Thermolabile proteinase K (NEB) ...
-
bioRxiv - Genetics 2020Quote: ... or phase 3 (Affymetrix Axiom) reference panels (Supplemental Tab ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 3 µL TCEP (Invitrogen) was added and the sample heated to 95 °C for 10 min ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 μL Lipofectamine 3000 (Invitrogen) was mixed with 47 μL Opti-Mem medium (Gibco) ...