Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 10000+ citations for 7 CHLORO 2 ETHYL 1H INDENE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cells were then harvested and stained with 7-AAD viability dye and Vybrant DyeCycle Violet (Invitrogen) according to the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from the cortices of 7-month-old mice using TRIzol reagent (Invitrogen) and RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Biophysics 2022Quote: HeLa (ECACC 93021013) and MCF-7 (ECACC 86012803) cells were cultured in MEM Alpha medium (Gibco), with GlutaMax (no nucleosides) ...
-
bioRxiv - Immunology 2022Quote: ... Frozen tissues were sectioned at 7 μm thick using CryoStar™ NX70 Cryostat (Thermo Fisher Scientific), then fixed in acetone ...
-
bioRxiv - Immunology 2019Quote: ... cells were treated with TURBO™ DNase (12 units/10^7 cells, cat# AM2239, ThermoFisher Scientific) for 1 hour at 37°C ...
-
bioRxiv - Physiology 2019Quote: ... 7 mg of protein were incubated with 343 μM Maleimide-PEG2-biotin (Thermo Fisher Scientific, #21901BID) at room temperature for 30 minutes with agitation by precipitating the alkylated protein with 1 mL of 100% cold acetone by incubating at −20°C for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... and TaqMan Primer/Probes was run on QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher) with standard settings ...
-
bioRxiv - Immunology 2021Quote: ... Target cell killing was measured using CellEvent™ Caspase-3/7 Green Detection Reagent (Life Technologies) and analyzed by flow cytometry.
-
bioRxiv - Neuroscience 2020Quote: ... 9.4% (1.023 g/ml) and 7% (1.017 g/ml) OptiprepTM (1.320 g/ml) (Thermo Fisher Scientific). After centrifugation at 800 x g for 15 min at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... Nuclei in the actin-stained samples were labeled with propidium iodide (7 µM, Molecular Probes, P3566). The stained samples were kept in PBS and visualized with a confocal laser scanning microscope (Leica TCS SP5X with a 40× /1.1 HCX PL Apo CS lens) ...
-
bioRxiv - Biophysics 2020Quote: ... hiPSCs were dissociated by incubating at 37°C for 7 minutes with TrypLE™ Express (ThermoFisher) and seeded at 125000 cells/cm2 on a Matrigel® coated 12 well plate ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were cooled on ice before addition of 7 mL of pre-chilled phenol/chloroform (Ambion) to precipitate proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... The viability dyes DAPI and 7-AAD were used where appropriate (BD and Thermo Fisher Scientific). CellTrace Far Red (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCRs were run in a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). Relative quantification was determined using the ΔΔCt method and normalized to the endogenous controls RPLP0 and GAPDH (GAPDH FWD 5’-3’= GTTCGACAGTCAGCCGCATC ...
-
bioRxiv - Plant Biology 2020Quote: ... using QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, MA, USA). The primer pairs used are listed in Table S3 ...
-
bioRxiv - Plant Biology 2020Quote: ... using QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, MA, USA). The primer pairs used are listed in Table S3 ...
-
bioRxiv - Bioengineering 2020Quote: ... and plates were read using a QuantstudioTM 7 Flex Real-Time PCR System (Thermo Fisher Scientific). Data was analyzed using the delta-delta CT method to generate box plots for a fold change of gene expression (with a fold change of 1 representing the gene expression of 100,000 hMSCs before seeding on scaffolds and composites) ...
-
bioRxiv - Microbiology 2020Quote: ... samples were desalted using HyperSep Filter Plates with a 5-7 µL bed volume (ThermoFisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... A Quantstudio 7 Flex Real-Time PCR System with Fast SYBR Green Master Mix (Applied Biosystems) was used for the analysis ...
-
bioRxiv - Microbiology 2020Quote: ... bait concentration was adjusted to a target of 7 nM by dilution with Blocker casein (ThermoFisher) or concentration using a 30kDa MWCO Vivaspin centrifugal filter.
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from 30 flies of 5-7 days old by TRIzol reagent (Invitrogen). The genomic template was removed using DNase (Takara) ...
-
bioRxiv - Cell Biology 2021Quote: ... Real-time PCR was then performed using the ViiA 7 RealTime PCR System (Thermo Fisher Scientific) with a TaqMan (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cultures were passaged every 5 to 7 days with collagenase type IV (Invitrogen; 1 mg/mL). The identities of all parental hESC and hiPSC lines were confirmed by DNA fingerprinting and all cell lines were regularly tested to exclude mycoplasma contaminations using a PCR-based assay ...
-
bioRxiv - Neuroscience 2022Quote: ... and 4 old (7 months) male fish were dissected immediately into cold PBS (pH 7.4, Gibco). The dissected brains were fixed with 4% paraformaldehyde (PFA ...
-
bioRxiv - Neuroscience 2022Quote: Primary mouse cortical neurons were transfected at DIV 7 using Lipofectamine LTX with Plus reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Quantification was performed by a sequence detector (ViiATM 7 Real-Time PCR System; Applied Biosystems, USA) using the TaqMan 5’ nuclease activity from the TaqMan Universal PCR Master Mix ...
-
bioRxiv - Cell Biology 2022Quote: ... 7- or 14-days post-IR sublingual glands using the RNAqueous Micro Kit (ThermoFisher Scientific, AM1931) and total RNAs were treated with DNase I (ThermoFisher Scientific) ...
-
bioRxiv - Bioengineering 2022Quote: ... the solution was purified with a 7 KDa spin desalting column (ThermoFisher Scientific; Waltham, MA, USA) to obtain tetrazine-functionalized protein G (PGTz) ...
-
bioRxiv - Bioengineering 2022Quote: MCF-7 Cells were fluorescently tagged with CellTracker™ Green CMTPX dye (Invitrogen™, Waltham, MA). A stock solution of 10 mM was prepared according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... MCF-7 WT and mutant cells were cultured in Minimum Essential Media (MEM, Thermo Fisher Scientific) with 5% fetal bovine serum ...
-
Mathematical characterization of population dynamics in breast cancer cells treated with doxorubicinbioRxiv - Cancer Biology 2021Quote: MCF-7 human breast cancer cells (ATCC HTB-22) were cultured in Minimum Essential Media (Gibco) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... qPCR was carried out on a real-time PCR system (Thermo Fisher Scientific; QuantiStudio 7 Flex) using the following conditions ...
-
bioRxiv - Immunology 2022Quote: ... bone marrow cells were isolated and propagated for 7 days in 30% L929-conditioned RPMI (Gibco) containing 20% FCS (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7×106 cells were resuspended in 500 μl of PBS and crosslinked using formaldehyde (Thermo Fisher) at 1% final concentration ...
-
bioRxiv - Physiology 2019Quote: ... were used for quantitative real-time PCR (qPCR) analysis via a Quantstudio 7 platform (Applied Biosystems). Relative gene expression was assessed by normalizing CT values (dCT ...
-
Biosynthesis of Circular RNA ciRS-7/CDR1as Is Mediated by Mammalian-Wide Interspersed Repeats (MIRs)bioRxiv - Molecular Biology 2019Quote: ... PCR-amplified a ciRS-7 fragment was subcloned into pcDNA5 FRT-TO vector (Thermo Fisher Scientific) using BamHI and Xhol sites ...
-
bioRxiv - Neuroscience 2019Quote: Dead and apoptotic cells were detected using CellEvent Caspase-3/7 Kit (#C10423, Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: The samples were then cycled in a QuantStudio 7 flex qPCR instrument (Applied Biosystems Cat# 4485701) at 50°C for 2 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 7 M urea polyacrylamide gel electrophoresis and stained with SYBR Gold (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Genetics 2019Quote: ... Neurons were harvested on day 7 and RNA was extracted using the PARIS kit from Ambion followed by TURBO DNase ...
-
bioRxiv - Synthetic Biology 2020Quote: COS-7 (ATCC® CRL-1651™) cells were cultured in DMEM medium (Thermo Fisher Scientific) supplemented with 10% FBS (fetal bovine serum ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were run in duplicates in ViiA™ 7 Real-Time PCR System (Thermo Fisher Scientific). 18S and β-actin served as endogenous controls (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... The real-time PCR was performed on QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems), with the 2ΔΔCt method for relative quantification (Livak and Schmittgen ...
-
bioRxiv - Cell Biology 2020Quote: ... and qRT-PCR was run in QuantStudio 7 Flex Real-Time PCR System (Thermo-Fisher Scientific) using SYBR Green Master Mix and gene-specific primers ...
-
bioRxiv - Microbiology 2020Quote: ... Amplification was performed in triplicate using either a QuantStudio 7 flex or QuantStudio 12K (Applied Biosystems) utilizing ...
-
bioRxiv - Bioengineering 2021Quote: ... Caspase 3/7 assay solution was mixed 1:1 with αMEM without phenol red (ThermoFisher Scientific) (caspase 3/7 lysis buffer ...
-
bioRxiv - Bioengineering 2021Quote: ... 96 hours and 7 days post-transfection or electroporation on an Attune NxT flow cytometer (Invitrogen). For 293T BFP reporter cells ...
-
bioRxiv - Bioengineering 2020Quote: ... PCR plates were read using a QuantstudioTM 7 Flex Real-Tim PCR System (Thermo Fisher Scientific). Results (n=5 ...
-
bioRxiv - Physiology 2020Quote: ... qRT-PCR was performed with a ViiA 7 detection system from Life Technologies (Thermo Fisher Scientific) using SYBR Green PCR master mix (Bioline) ...
-
bioRxiv - Immunology 2021Quote: ... Five minutes prior to analysis 5 μg/ml 7-amino actinomycin D (Life Technologies, CA, USA) was added for exclusion of dead cells ...