Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... with 5 μL of Lipofectamine 3000 reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... twenty four 5 ml culture tubes (Fisher Scientific, Catalog no ...
-
bioRxiv - Bioengineering 2024Quote: ... lipopolysaccharide was added (LPS, 5 μg/mL, Invitrogen) and to an M2 phenotype ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 5% fetal bovine serum (Gibco, A3160502), 10 ng/mL bFGF (PeproTech ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 5 % fetal bovine serum (FBS, Gibco). Penicillin and streptomycine (final concentrations 100 U mL−1 and 100 µg mL−1 ...
-
bioRxiv - Neuroscience 2024Quote: ... and DAPI (5 µg/µl; Invitrogen, Carlsbad, CA) in blocking buffer for 1–2 h at RT ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 5 µL of 7AAD (Invitrogen, CAT#: A1310) were added to each sample and to the double positive tube ...
-
bioRxiv - Microbiology 2024Quote: ... in Applied Biosystems QuantStudio 5 (Thermo Fisher Scientific). The transcripts of either NbActin or CcActin were selected as an internal control to normalize the data ...
-
bioRxiv - Neuroscience 2024Quote: ... filled with 5% agarose (Invitrogen, cat# 15517-014) dissolved in dH2O ...
-
bioRxiv - Neuroscience 2024Quote: ... with 5% KnockOut Serum replacement (Gibco, Cat # 10828028). hAstrocyte transwells were then moved to a new plate and treated with either vehicle (DMSO ...
-
bioRxiv - Bioengineering 2024Quote: ... and 5 ng/mL Human Recombinant EGF (Gibco) following manufacturer instructions ...
-
bioRxiv - Genetics 2024Quote: ... 400 µL acid phenol: chloroform 5: 1 (Ambion) was added ...
-
bioRxiv - Physiology 2024Quote: ... and then blocked with 5% goat serum (Invitrogen) in PBST for 45 min at room temperature ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 μM MitoSOXTM Red (Thermo Fisher Scientific, M36008) and 1 μM Fluo-4 AM (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% glycerol and 50x Dynabeads MyOne (ThermoFisher#65601) was applied on the grid ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% CO2 on Coating Matrix Kit Protein (Gibco) coated flasks ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5% CO2 and passaged using Trypsin (Gibco, #15400054) in the presence of an anti-antimycotic antibiotic (Gibco ...
-
bioRxiv - Biophysics 2024Quote: ... medium supplemented with 5% fetal bovine serum (Gibco), 100 U/mL penicillin and streptomycin (Thermo Fisher Scientific) ...
-
bioRxiv - Developmental Biology 2021Quote: ... PCR was performed on lysates to amplify the genomic region targeted by the sgB with primers forward 5’GGGTGTTGTTCAGCGATGGA and reverse 5’ATAGATCTCATTGTGATCGA using Phusion High-Fidelity DNA polymerase (Thermo Scientific). The amplicons were cloned in pCR-bluntII-TOPO vector (Zero Blunt Topo PCR cloning kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... The amplicon of the-2.3etv2 promoter was synthesised from zebrafish genomic DNA with a forward primer 5’- TATAGGGCGAATTGggtaccTTCAGTAAGCAGACTCCTTCAATCA -3’ and a reverse primer 5’- AGCTGGAGCTCCAccgcggTTCGGCATACTGCTGTTGGAC -3’ by Phusion High-Fidelity DNA Polymerase (Thermo Scientific) as an insert for In-Fusion Cloning (Takara Bio ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were loaded onto a C18 AcclaimTM PepMapTM trap column (100 Å, 5 μm × 0.3 mm × 5 mm, Thermo Fisher Scientific) and washed for 3 min at 30 μL/min before peptides were eluted onto a C18 AcclaimTM PepMapTM column (100 Å ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination (VP1 to 2C) was amplified using primers PV3-F (5′-GCAAACATCTTCCAACCCGTCC-3′) and PV1-R (5′-TTGCTCTTGAACTGTATGTAGTTG-3′) and Taq polymerase (Life Technologies) with an initial denaturing at 94°C for 3 min ...
-
bioRxiv - Microbiology 2022Quote: ... 16S rRNA gene was amplified using primers 8F (5’-AGAGTTTGATCCTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) by colony PCR (Vaishnava et al., 2011) using DreamTaq Master Mix (ThermoFisher Scientific) and 0.2μM primers ...
-
Targeted rescue of synaptic plasticity improves cognitive decline after severe systemic inflammationbioRxiv - Neuroscience 2021Quote: ... using the oligonucleotides WPRE-F 5’-TGCTTCCCGTATGGCTTTCAT-3’ and WPRE-R 5’-CAGCAAACACAGTGCACACC-3’ as primers and SYBR Select Master Mix (ThermoFisher Scientific). The measurements were performed with a CFX384 instrument (Biorad ...
-
bioRxiv - Molecular Biology 2021Quote: ... synthetic EMCV RNA variants (Table 5) were dissolved in distilled water and labelled at the 5’ end with Dylight 650 maleimide conjugates (Thermo Scientific) using the 5′ EndTag kit (Vector Labs ...
-
bioRxiv - Immunology 2021Quote: ... was added as the secondary antibody at a 1:2000 dilution for 1 h at 37C, followed by adding TMB (3, 3, 5, 5’-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) for about 15 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... and diluted to 30 pg/μl concentration in 5 mM Tris-HCl (pH 7.5) supplemented with 5 ng/µl carrier herring sperm (Thermo Fisher Scientific). The MSI assay was performed using single-molecule PCR (SM-PCR ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.5 µg of RNA was heated for 5 min to 65°C and cDNA was generated using SuperScript III (Life Technologies) and random primers for 1 h at 50°C followed by heat inactivation for 15 min at 70°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the following primers c=myb-F 5’-CCAAGTCAGGAAAACGCCACCTCG-3’ and c-myb-R 5’-GCTGTTGTTTAGCGGAGTTGGGCT-3’ and cloned into the dual promoter vector pCRII-TOPO (Life Technologies). The pCS2:runx1 probe was a gift from Leonard Zon ...
-
bioRxiv - Biophysics 2019Quote: Peptide digests were dried by vacuum centrifugation and dissolved in 20 µl of 5% formic acid and injected at a flow rate of 5 μl/min onto an Acclaim PepMap 100 μm × 2 cm NanoViper 5-μm C18 trap (Thermo Scientific) using mobile phase A containing water and 0.1% formic acid ...
-
bioRxiv - Synthetic Biology 2019Quote: ... × 5 mm 5 µm 100 Å and an Acclaim PepMap RSLC 75 µm × 25 cm 2 µm 100 Å (Thermo Scientific). The columns were installed on an Ultimate 3000 RSLCnano system (Dionex) ...
-
bioRxiv - Genomics 2020Quote: ... using forward primer (5’-TGATTATCGACATCCCGTCA-3’) and reverse primer (5’-GTCTGGAATCTCATAGGTAG-3’) and run on an ABI 7500 thermocycler (Applied Biosystems). Primer specificity and capture temperature were determined by melt curve analysis ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA in the vicinity of the rs7143400 was amplified by PCR using the following primers 5’-GGTTGGGTGTGAATAGGAAT-3’ and 5’-TGCATGCCTGATTTATTTGG-3’ before digestion with Tsp45I enzyme (Thermo Scientific). Finally ...
-
bioRxiv - Molecular Biology 2021Quote: ... Analysis of global levels of 5-mdC and 5-hmdC were performed on a Q exactive mass spectrometer (Thermo Fisher Scientific). It was equipped with an electrospray ionization source (H-ESI II Probe ...
-
bioRxiv - Biochemistry 2021Quote: ... Approximately 1 μg of peptides were desalted on a trap column (Acclaim PepMap100 C18, 5 μm, 100 Å, 300 μm i.d. × 5 mm, Thermo Scientific) and then separated on an in-house packed column (75 μm i.d ...
-
bioRxiv - Cell Biology 2021Quote: ... and resuspended into 5 mL of warm PBS containing 5 μg mL−1 Hoechst 33342 (Thermo Fisher Scientific, Waltham, MA, USA) to stain live leukocytes.
-
bioRxiv - Microbiology 2020Quote: Experiments to determine the sensitivity of the two RT-qPCR methods and nested PCR were completed using serial dilutions of each transcript (5*103 to 10−1 copies/5 µL) in a previously described RNA storage buffer containing RNA storage solution (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Resulting colonies were screened for plasmid presence by PCR of a portion of the pESC-URA-lpt1 plasmid (Forward primer: 5’-TTGGAAACAGCTCCAAATCC-3’, Reverse primer: 5’ CCCAAAACCTTCTCAAGCAA-3’; ordered from ThermoFisher Oligos) and preserved as glycerol stocks.
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2020Quote: Parasites after treatment were washed in 5 mL complete medium at 400 g for 3 min and stained with 5 μM JC-1 (ThermoFisher Scientific) in complete medium in the dark at 37 °C for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... the Peptides were trapped for 10 min on a precolumn (Acclaim PepMap100, C18, 5 μm, 100 Å, 300 μm i.d. × 5 mm, Thermo Scientific) and subsequently separated using an analytical column (Easyspray 50 cm column (ES803 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 800 ng of digests were loaded in random order onto a pre-column (C18 PepMap 100, 5 µm, 100 A, 300 µm i.d. x 5 mm length, Thermo Fisher, 160454) at a flow rate of 50 µL/min with solvent C (0.05% TFA in water/acetonitrile 98:2).
-
bioRxiv - Neuroscience 2020Quote: ... then four times in PBS for 5 minutes (5 minutes for each wash) before mounting with Floromount G (Thermo Fisher Scientific). Slices were imaged an Olympus VS120 slide scanning microscope ...
-
bioRxiv - Developmental Biology 2022Quote: ... were retrotranscribed from either 5’-CATGCTGCTGGTGGGTGTGCT-3’ or 5’-CCATAAAGCACCGGTGAGCAGAA-3’ endoglin specific reverse oligonucleotides (500 nM) using RevertAid H minus reverse Transcriptase (Thermo Scientific) 10 U/μl in 1X RevertAid H minus Buffer supplemented with 2 U/μl RNAse OUT (Thermo Scientific) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Embryos were then washed twice for 5 min each in PBS and subsequently incubated with 5 µg/ml Hoechst 33342 (Invitrogen, USA) in PBS for 5 min to stain the nuclei ...
-
bioRxiv - Microbiology 2022Quote: ... 2.5 x 107, or 5 x 107 PFU/mL (MOI of 5, 50, or 100 respectively) in CO2-independent medium (Gibco Life Technologies) supplemented with 0.1% (w/v ...
-
bioRxiv - Biophysics 2022Quote: ... and SN25 FL (1–206, R59C) or truncation mutant (11–206, R59C) were labeled with 5×molar excess Tetramethylrhodamine-5-maleimide (TMR) (Molecular Probes) in 25 mM HEPES pH 7.4 ...
-
bioRxiv - Cell Biology 2022Quote: ... Peptides were loaded onto a μ-precolumn (Acclaim PepMap 100 C18, cartridge, 300 μm i.d.×5 mm, 5 μm) (Thermo Scientific), and were separated on a 50 cm reversed-phase liquid chromatographic column (0.075 mm ID ...
-
bioRxiv - Developmental Biology 2021Quote: ... Tryptic peptide mixtures were injected automatically and loaded at a flow rate of 30 μl/min in 0.1% trifluoroacetic acid in HPLC-grade water onto a nano trap column (300 μm i.d. × 5 mm Pre column, packed with Acclaim PepMap100 C18, 5 μm, 100 Å; Thermo Scientific). After 3 minutes ...
-
bioRxiv - Neuroscience 2021Quote: The successfully reprogrammed hiPSCs were incubated in hypoxic conditions (5% CO2, 5% O2) at 37°C and maintained in StemFlex™ media (Gibco) on 6-well NUNC™ plates (ThermoFisher ...