Labshake search
Citations for Thermo Fisher :
1701 - 1750 of 10000+ citations for Human β Amyloid 1 42 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... and PDGF-D by enzyme-linked immunosorbent assay (ELISA, TGF-β: Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... to knockdown β-catenin using Lipofectamine™ RNAiMAX Transfection Reagent (Invitrogen™, 13778150). For TopFlash reporter assay ...
-
bioRxiv - Microbiology 2020Quote: ... we used a β-actin gene specific forward primer “CGGCCTTGGAGTGTGTATTAAGTA” (Invitrogen, Carlsbad, CA) and reverse primer “TGCAAAGAACACGGCTAAGTGT” (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10 μg of protein plus LDS Sample buffer/10% β-mercaptoethanol (Invitrogen NP0007) were separate by PAGE on a 4–12% Bis-Tris polyacrylamide gel (Biorad 3450125) ...
-
bioRxiv - Immunology 2019Quote: ... 500 U penicillin-streptomycin (PAA laboratories) and 50 μM β-mercaptoethanol (Life Technologies). To polarize the cells towards a Th17 phenotype ...
-
bioRxiv - Immunology 2019Quote: ... 500 U penicillin-streptomycin (PAA laboratories) and 50 μM β-mercaptoethanol (Life Technologies). For Th17 induction ...
-
bioRxiv - Genetics 2019Quote: ... 150 mM β-mercaptoethanol) and quantified using A280 from a NanoDrop (Thermo Scientific). 40-50μg of protein was analysed by SDS–polyacrylamide gel electrophoresis (SDS–PAGE ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... 1X MEM nonessential amino acids and 0.01 mM β-mercaptoethanol (ThermoFisher, Waltham, MA). Sensory neuron differentiation began on day 2 with the addition of 3 μM CHIR99021 ...
-
bioRxiv - Physiology 2021Quote: ... Lipocalin-2 Lcn2 and house-keeping gene β-Actin (Life Technologies, Carlsbad, CA). The CT value for the gene of interest was first normalised by deducting CT value for β-Actin to obtain a delta CT value ...
-
bioRxiv - Immunology 2020Quote: ... 100 μg/ml streptomycin and 50 μM β-mercaptoethanol (all from Life Technologies).
-
bioRxiv - Developmental Biology 2020Quote: ... and 10 mM β-glycerol phosphate (AC410991000, Thermo Fisher Scientific, Waltham, MA, USA) for 5 days ...
-
bioRxiv - Developmental Biology 2020Quote: ... a TaqMan probe against mouse β-actin as a reference gene (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... or β-galactosidase activity was determined using Tropix Gal-Screen™ (Applied Biosystems) and Buffer A (Applied Biosystems) ...
-
bioRxiv - Physiology 2022Quote: ... β-like- cell clusters derived from iPSCs were dissociated using TrypLE Express (ThermoFisher) as described 47 ...
-
bioRxiv - Microbiology 2022Quote: ... CRM1 and mouse monoclonal antibody for β-actin were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2022Quote: ... supplied with β-mercaptoethanol for RNA extraction or RIPA buffer (Thermo Fisher Scientific) supplied with protease and phosphatase inhibitors (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Alexa Fluor 647-conjugated anti-β-tubulin (9F3) rabbit mAb (Thermo Fisher Scientific) to visualize cilia ...
-
bioRxiv - Synthetic Biology 2022Quote: ... We used 5-chloromethylfluoresecein di-β-D-galactopyranoside (CMFDG; Invitrogen, Waltham, MA, USA) as a substrate of LacZ at a final concentration of 33 μM ...
-
bioRxiv - Pathology 2023Quote: ... The protein levels of TGF-β (88-50680-22, Thermo Fisher Scientific, JPN), HA (Hyaluronan Quantikine ELISA Kit ...
-
bioRxiv - Pathology 2023Quote: ... The protein levels of TGF-β (88-50680-22, Thermo Fisher Scientific, JPN), HA (Hyaluronan Quantikine ELISA Kit ...
-
bioRxiv - Cell Biology 2023Quote: ... laminarin (β-1,3-glucan, Thermo Fisher; 250 µg/ mL in milli-Q water), chitin (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... 17.5 µl of β-mercaptoethanol in 50 ml media (Gibco, Cat. #21985-023), and 1% B-27 supplement (Gibco ...
-
bioRxiv - Immunology 2022Quote: ... 50 μM β-Mercaptoethanol and 50 U/ml penicillin/streptomycin (all from Gibco) before being used in chemotactic assays ...
-
bioRxiv - Microbiology 2023Quote: ... and ProcartaPlex mouse IFN-α/IFN-β 2-plex (ThermoFisher, EPX02A-22187-901) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... A mouse IgG anti-β-Lac antibody (clone: 3E11.G3, Thermo Fisher Scientific) was used to capture recombinant β-Lac and primary murine serum samples were used as primary antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... Indole-3-carbinol (97%) and β-Naphthoflavone (98+%) were obtained from Thermo Scientific™ (122190250 and A18543.06 ...
-
bioRxiv - Cancer Biology 2023Quote: ... β-mercaptoethanol and Type II Collagenase were from Gibco (Thermo Fisher Scientific, USA).
-
bioRxiv - Immunology 2023Quote: The ECN90 β-cell line33 was maintained in DMEM/F12 Advanced medium (ThermoFisher) supplemented with 2% bovine serum albumin (BSA ...
-
bioRxiv - Bioengineering 2023Quote: ... add 1mM β-mercaptoethanol) with 20 U of MNase (Thermo Scientific Cat. EN0181). Chromatin was digested with MNase at 37 °C for 15 ...
-
bioRxiv - Immunology 2024Quote: ... and 0.1% β-mercaptoethanol in the presence of αCD3/CD28 beads (Thermofisher, #11456D). The stimulants for Th differentiation ...
-
bioRxiv - Cell Biology 2023Quote: ... Unlabeled Xenopus β-globin RNA was transcribed with the MEGAscript T7 kit (ThermoFisher) using a PCR product generated from pSP64:XBM43 (see Table S3 for primers).
-
bioRxiv - Microbiology 2024Quote: ... 200 μl of 4 mg/ml ONPG (ortho-nitrophenyl-β-galactoside, Thermo Scientific) was added ...
-
bioRxiv - Bioengineering 2023Quote: SA-β-Gal was stained using CellEvent™ Senescence Green Detection Kit (Invitrogen), following manufacturer guidelines ...
-
bioRxiv - Immunology 2021Quote: ... Proliferation was triggered by the stimulation with Dynabeads Human T-Activator CD3/CD28 (ratio 1:2, Thermo Fisher Scientific). The arginase inhibitor OAT-1746 (1500 nM) ...
-
bioRxiv - Immunology 2020Quote: ... The human monocytic THP-1 cell line was maintained in RPMI-1640 (made inhouse, RPMI 1640 powder (Life Technologies), 23.8mM Sodium Bicarbonate (NaHCO3 ...
-
bioRxiv - Immunology 2021Quote: ... NAFs/CAFs ± SI were added to wells of lymphocytes at a concentration of 1×104 cells/100μl (ratio of 1:10 NAFs/CAFs:lymphocytes) of human complete MSC medium (RPMI 1640 medium (ThermoFisher Scientific) supplemented with 10% heat-inactivated FBS ...
-
bioRxiv - Biochemistry 2020Quote: Cas9 was produced by IVT using either a continuous exchange 1-Step Human Coupled IVT Kit (Thermo Fisher Scientific) or a PURExpress bacterial IVT kit (New England Biolabs) ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were then washed once with PBS and incubated with 1 ug/ml anti-human (Alexa Fluor 647; Invitrogen) secondary Abs and the viability dye AquaVivid (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... The human myelomonocytic leukemia cell line THP-1 was propagated in RPMI 1640 medium (GIBCO® Life Technologies™) supplemented with 10% fetal calf serum (FCS ...
-
bioRxiv - Neuroscience 2019Quote: ... for 1 h at room temperature and then exposed to antibodies specific for human LMP7 (ThermoFisher Scientific; MA5-15890) or PRDX6 (Abcam ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA (1 μg) preparations were hybridized on the PrimeView Human Gene Expression Array (Affymetrix, Thermo Fisher Scientific, USA) at the core facility Biomedizinisches Forschungszentrum (BMFZ ...
-
bioRxiv - Cell Biology 2021Quote: Total RNA (1 μg) preparations were hybridized on the PrimeView Human Gene Expression Array (Affymetrix, Thermo Fisher Scientific, USA) at the core facility Biomedizinisches Forschungszentrum (BMFZ ...
-
bioRxiv - Cell Biology 2021Quote: ... The following secondary antibodies were used at 1:200 for IF experiments: Anti-human-Alexa-633 (Life Technologies #A21091), anti-mouse-Alexa-488 (Life Technologies #A11029) ...
-
bioRxiv - Molecular Biology 2022Quote: Human Embryonic Kidney (HEK293T) cells were cultured in high glucose DMEM with 10% FBS and 1% Penicillin/Streptomycin (Gibco) in a 37°C incubator with 5% CO2 ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: 1 mL of human plasma was incubated with 0.5 mL of Invitrogen total exosome isolation reagent (Thermo Fisher Scientific) overnight at 4°C and the day after was centrifuged at 10,000 x g for 1h at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... Alpha-actinin-1-M-sstFRET containing the sstFRET module inserted between 300aa and 301aa within the first spectrin repeat of human alpha-actinin-1 (P12814.2) was in the neomyocin selectable pcDNA3.1 expression vector (Invitrogen/ThermoFisher). Actinin-C-sstFRET containing the sstFRET module added to the C-terminus of human alpha-actinin-1 (P12814.2 ...
-
bioRxiv - Microbiology 2021Quote: ... falciparum NF54 parasites were cultivated at 4% hematocrit in human B+ blood in RPMI-HEPES supplemented with 0.25% Albumax 1 (Invitrogen) and human donor plasma type B+ ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 1 day prior to spinfection cells were activated using Human T-activator CD3/CD28 Dynabeads (Thermo Fisher, 11131D) and cultured in 200U/ml IL-2 ...
-
bioRxiv - Bioengineering 2021Quote: ... Another subset of slides was labeled with Alexa 568 conjugated anti-human IgG antibody (1:800, ThermoFisher, A-21090) to detect the Fc portion of the EphA4-Fc chimera peptide.
-
bioRxiv - Immunology 2020Quote: Human PBMCs were incubated with MitoSOX Red (5μM) and Mitotracker Green (1 μM) (both from Molecular Probes, Life Technologies) in PBS during 10 minutes at 37°C before flow cytometry extra-cellular staining.