Labshake search
Citations for Thermo Fisher :
1701 - 1750 of 10000+ citations for 6H Pyrido 4 3 b carbazole 9 methoxy 5 6 11 trimethyl since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... 3 min each) and digested for 5 min with proteinase K (10μg/mL; Ambion). Tissue sections were allowed to hybridize overnight in a humid chamber at 65°C with 1 ng/µL of sense (negative probe ...
-
bioRxiv - Neuroscience 2019Quote: ... After 3 washes Hoechst 33258 nuclear stain (ThermoFisher H3569, 1:1500 for 5 min) was used to counter stain the nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg mtDNA were digested with 3 ul DraI Fastdigest restriction enzyme (Thermo Scientific) at 37°C for 3h and extracted with 1 volume phenol-chloroform ...
-
bioRxiv - Microbiology 2022Quote: ... FAM-5=CAT CCA ATC AAA GAC ATT GCG A 3=-TAMRA (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were washed 3 × 5 min and mounted on slides using Prolong Gold (Invitrogen). Deconvolution wide-field microscopy was performed using the DeltaVision Elite system equipped with an NA 1.42 60x PlanApo objective (Olympus ...
-
bioRxiv - Developmental Biology 2022Quote: ... zLL 5’- and 3’- RACE PCRs were performed using the GeneRacer core kit (Invitrogen). Total RNA (2 µg ...
-
bioRxiv - Cell Biology 2022Quote: ... CCDC66 was depleted using an siRNA with the sequence 5′-CAGTGTAATCAGTTCACAAtt-3′ (Thermo Scientific). Silencer Select Negative Control No ...
-
bioRxiv - Cell Biology 2024Quote: ... si-PRELID1: 5’-CCCGAAUCCCUAUAGCAAA-3’) were transfected using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778075). Assays were normally carried out 48 h after transfection ...
-
bioRxiv - Genomics 2024Quote: ... and a QuantStudio 3 or QuantStudio 5 Real-Time PCR instrument (Applied Biosystems™). Primers used for qPCR are listed in Suppl ...
-
bioRxiv - Immunology 2024Quote: ... tonsils were rinsed 3 x 5 minutes with 1X PBS (10010023, ThermoFisher Scientific, USA) without agitation ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... CCDC15 was depleted using an siRNA with sequence 5′-GCAGUACCUGAGACAUAGAtt-3′ (Ambion, Cat. # s36888). For depletion of POC5 ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae at 5 dpf were incubated in 3 µM FM 1-43 (Thermofisher, T3163) in E3 media for 35 s ...
-
bioRxiv - Molecular Biology 2022Quote: ... and modified pLX301 vectors 9 containing either a siRNA-resistant version of HA-NOL7 CDS or empty vector in a 1:9:10 ratio (1 μg:9 μg:10 μg for a 10-cm plate) with Lipofectamine 2000 (Life Technologies, 11668019) per manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: ... interleukin 6 (IL-6; Invitrogen, Carlsbad, CA), plasminogen activator inhibitor 1 (PAI-1 ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C in a 5% CO2 incubator with daily media changes and were passaged every 4-5 days using TrypLETM (ThermoFisher), following manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2021Quote: ... were incubated for 4 h in DMEM/F12 containing 5% horse serum (Gibco) and 5% foetal bovine serum (Gibco ...
-
bioRxiv - Molecular Biology 2021Quote: ... Total RNA (5 μg) was separated in 4-20% TBE gel (ThermoFisher scientific), described above.
-
bioRxiv - Microbiology 2021Quote: ... 14.5 μl of preheated reaction mixture [4 μl First Strand buffer (5 ×, Invitrogen), 1 μl 0.1 M dithiothreitol ...
-
bioRxiv - Microbiology 2020Quote: ... HIOs were cultured in groups of 5/well using 4-well plates (ThermoFisher). Individual HIO lumens were microinjected using a glass caliber needle with 1μl of PBS control or different STm mutants (105CFU/HIO or 103CFU/HIO for 24h infections) ...
-
bioRxiv - Pathology 2021Quote: ... washed platelets were stained with Fluo-4 AM (5 μM, Thermo Fisher Scientific) for 30 min at 37°C ...
-
bioRxiv - Systems Biology 2022Quote: ... the reaction was quenched with 4 μl of 5% hydroxylamine (ThermoFisher Scientific, 90115) for 15 min ...
-
bioRxiv - Microbiology 2023Quote: ... which included 5 µL 4× Taqman Fast Advanced Master Mix (Thermo Fisher Scientific), 0.4 µL of each primer (tat 2.0 and rev ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were loaded with 5 μM of Fluo-4-AM (Thermo Fisher Scientific) for 50 min at room temperature in the dark ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% CO2 for 4 minutes and resuspended in E8 medium (Thermo Fisher Scientific) and 10 μM Y-27632 Rho-kinase inhibitor (ROCKi ...
-
bioRxiv - Bioengineering 2023Quote: ... calcium imaging was performed using 5 μM Fluo-4-AM (ThermoFisher, F14201, US) in Krebs-Ringer’s solution containing NaCl 119 mM ...
-
bioRxiv - Genomics 2023Quote: ... hiPSC-CMs were loaded with Fluo-4-acetoxymethyl (AM)-ester (5 μM, Invitrogen) in Tyrode’s buffer (135 mM NaCl ...
-
bioRxiv - Immunology 2022Quote: ... 0.1 mM EDTA) for 5 minutes at room temperature and then neutralized with B cell media (RPMI 1640 with L-glutamine (Gibco) supplemented with 15% fetal bovine serum (Corning) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and cultured at 5% O2 in Dulbecco’s modified essential medium (DMEM)/F12 with B-27 minus vitamin A (Life Technologies), 1% penicillin-streptomycin ...
-
bioRxiv - Neuroscience 2023Quote: ... Cultures were maintained in NGM (500 ml Neurobasal-A Medium, 10 ml B-27, and 5 ml Glutamax, from Gibco, ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Cultures were maintained in NGM (500 ml Neurobasal-A Medium, 10 ml B-27, and 5 ml Glutamax, from Gibco, ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: The murine CH27 B-cell lymphoma line was cultured at 37°C and 5% CO2 in 1640 RPMI (Life technologies) supplemented with 10% FCS (Biowest) ...
-
bioRxiv - Physiology 2023Quote: ... was incubated with 5 µl Zenon component A solution for five minutes and then with 5 µl Zenon component B solution (ZenonTM Mouse IgG1 Labeling Kit Z-25006, Alexa Fluor 568, Invitrogen). PBS with 0.1% triton was added to the Zenon-labeled antibody mix to a final 1:75 dilution ...
-
bioRxiv - Plant Biology 2019Quote: ... The seeds were rinsed three times with sterile distilled water and germinated on basal Murashige and Skoog (MS) medium [39] (Duchefa Biochemie B. V., Netherlands) containing 3% (w/v) sucrose (Fisher Scientific, USA) and 0.35% (w/v ...
-
bioRxiv - Neuroscience 2020Quote: ... Some slices (used for experiments in Fig. 2 and 3) were cultured in media that included 2 % B-27 Supplement (Thermo Fisher Scientific). Slices were maintained at 37°C and 5 % CO2 and used for experiments at DIV10-15.
-
bioRxiv - Physiology 2023Quote: ... IALVs were then washed with PBS containing 0.1% Triton X-100 (PBST) 3 times and blocked for a minimum of 2 hr with Blockaid® (B-10710, ThermoFisher Scientific). IALVs were then stained with the corresponding primary antibodies in BlockAid® Solution ...
-
bioRxiv - Cell Biology 2023Quote: Overlay of EM and LM data (Fig. 3) and most of the segmentations (Fig. 4A,B,D,E) were done using Amira (Thermo Fisher Scientific). Additional segmentation was performed using Microscopy Image Browser (Belevich et al ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 1% penicillin/streptomycin with passaging every 3–4 days using in DPBS (Life technologies) supplemented with 0.5 mM EDTA (Life technologies ...
-
bioRxiv - Genomics 2020Quote: ... Abl.3 and Abl.4 (13) were cultured in Roswell Park Memorial Institute medium (Gibco), containing 15% FBS (Sigma) ...
-
bioRxiv - Cell Biology 2021Quote: HAEC cells (passage 3-4) were lysed in ice-cold RIPA buffer (ThermoFisher, cat# 89900) containing protease and phosphatase inhibitors (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell number was determined every 3-4 days using the Countess automated cell counter (Invitrogen). 20,000 cells were then re-plated with fresh media and compound ...
-
bioRxiv - Neuroscience 2019Quote: ... Lines were passaged every 3-4 days using enzymatic detachment with Stempro Accutase (ThermoFisher; A1110501) for 5 minutes and re-plated in mTeSR1 medium with 10µM Rock Inhibitor (Y2732 ...
-
bioRxiv - Biochemistry 2021Quote: ... RNA was isolated from approximately 3-4 x 107 cells using TRIzol reagent (Thermo Fisher), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... for 3-4 hr in the presence of brefeldin A (BFA; 10ug/mL; Life Technologies).
-
bioRxiv - Neuroscience 2022Quote: Hippocampal neurons were transfected at day in vitro (DIV)3-4 using Lipofectamine 2000 (Invitrogen). Shortly ...
-
Migration and establishment of progenitor pool of melanocytes is governed by SEMA3E-PLXND1 signalingbioRxiv - Developmental Biology 2023Quote: ... cells were switched to M254 medium for 3-4 population doublings (Thermofisher Scientific, Life Technologies).
-
Migration and establishment of progenitor pool of melanocytes is governed by SEMA3E-PLXND1 signalingbioRxiv - Developmental Biology 2023Quote: ... cells were switched to M254 medium for 3-4 population doublings (Thermofisher Scientific, Life Technologies).