Labshake search
Citations for Thermo Fisher :
1701 - 1750 of 10000+ citations for 4' Bromo 3' fluoro 2 morpholinomethyl benzophenone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2024Quote: ... total RNA was extracted from 2–3-day-old female adult mosquitoes using TRIzol Reagent (Thermo Fisher Scientific, MA, USA). The reverse transcription reaction was performed in a 20 μl reaction mixture with 5 μg total RNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... LentiX HEK293T and 143b osteosarcoma cells adherent cell lines were passaged every 2-3 days by dissociating in 0.05% trypsin (Life Technologies) for 5 min at 37 °C or 1x DPBS supplemented with 2% FBS and 5 mM EDTA for 10 - 15 min at 37 °C to remove from culture plates ...
-
Bio-orthogonal Glycan Imaging of Culture Cells and Whole Animal C. elegans with Expansion MicroscopybioRxiv - Bioengineering 2024Quote: ... were incubated at 37°C for 2 h and analyzed by SDS-PAGE on a 3-8% tris-acete NuPAGE gel (Invitrogen) and stained with Pierce Silver Stain Kit (Thermo Scientific ...
-
bioRxiv - Systems Biology 2023Quote: ... assembly was performed by mixing 2-3 sgRNAs (a total of 120 pmol) with 8.5 μg recombinant Cas9 (Invitrogen A36499). The resulting RNP mix was electroporated into 0.3×106 MV411 cells using a Lonza 4D Nucleofector ...
-
bioRxiv - Molecular Biology 2022Quote: 4 L exponentially growing Sf9 cells at a density of 2-3 × 106 cells/mL in Sf900-III SFM media (Invitrogen) was infected with the high-titer baculovirus stock ...
-
bioRxiv - Microbiology 2023Quote: ... Five microliters were loaded onto an Acclaim PepMap™ precolumn (75 μm × 2 cm, 3 μm, 100 Å; Thermo Scientific) equilibrated in solvent A and separated at a constant flow rate of 250 nL/min on a PepMap™ RSLC C18 Easy-Spray column (75 μm × 50 cm ...
-
bioRxiv - Immunology 2022Quote: ... The dissociated cells were washed 3 times with chilled PBS containing 1% heat-inactivated FBS and 2 mM EDTA (Gibco).
-
bioRxiv - Biochemistry 2023Quote: ... In between wash steps the beads were incubated for 3 min on a magnetic stand (DynaMag 2, DYNAL®, Invitrogen). Then ...
-
bioRxiv - Cell Biology 2023Quote: ... C3H female mouse in origin) were cultured every 2-3 days using 0.25% Trypsin-EDTA and maintained in DMEM (GIBCO, 11965118) supplemented with 20% iFBS and 1% Penicillin/Streptomycin ...
-
bioRxiv - Cancer Biology 2023Quote: ... Buffy coat was mixed 1:2 with PBS and added onto a Ficoll gradient in a 3:1 ratio (Invitrogen). This was centrifuged at 2100 rpm for 25 minutes at RT (w/o brakes) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 min) and suspended in 50 µl of TSB-FBS supplemented with 2 U of DNase I (Thermo Fisher Scientific). After 5 min incubation at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 min) and suspended in 30 µl of TSB-FBS supplemented with 2 U of DNase I (Thermo Fisher Scientific). After 5 min incubation at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... Washes of 3 x 1ml PGAS and 2 x 1ml PBS followed by 1ml PBS containing 1μg/ml Hoechst 33342 (Life Technologies) and finally 2 washes in dH2O prior to mounting on glass slides with Mowiol 4-88 (Polysciences Inc.) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Libraries were prepared for long-read sequencing by digesting 2 µg of a level 3 plasmid library using Esp3I (Thermofisher) and purifying linearized fragments using a 0.5x volume of magnetic beads (Omega Bio-Tek ...
-
bioRxiv - Immunology 2023Quote: ... Purified T cells were activated for 1 to 3 days with Human T-Activator anti-CD3/CD28 dynabeads at a 1:2 bead-to-cell ratio (Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2023Quote: ... For the construction of the RNH2A KO clones, RNASEH2A (Chr19, exon 2) gRNA (5’-TAACAGATGGCGTAGACCAT-3’) was cloned into GeneArtTM CRISPR Nuclease Vector with OFP reporter (Invitrogen) following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The isolated cells were expanded in tissue culture flasks for 2-3 days in proliferation medium containing DMEM/F-12 media (Gibco), penicillin-streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2023Quote: ... Ten microliters of each sample were loaded onto a trap column (100 mm i.d. x 2 cm; Acclaim PepMap C18, 3 mm, 100A; ThermoFisher 164564) in 0.1% formic acid in water ...
-
bioRxiv - Bioengineering 2023Quote: ... cells in each well were firstly washed with flow cytometry staining buffer: 3% FCS with 2 mM EDTA (15575020; Invitrogen) in PBS− ...
-
bioRxiv - Biochemistry 2023Quote: ... Each sample of peptides was loaded onto a C18 trap column (75 μm ID × 2 cm, 3 μm, Thermo Scientific) and then separated on a C18 analytical column (75 μm ID×50 cm ...
-
bioRxiv - Cell Biology 2023Quote: ... induction medium was replaced every 2-3 days by mature medium containing StemPro-34 SF medium (Gibco, Thermo Fisher Scientific), GlutaMAX (10 μl/ml ...
-
bioRxiv - Plant Biology 2023Quote: ... PI staining seedlings were washed for 2-3 min in water and transferred to a chambered cover glass (Thermo Scientific), and imaged either using Confocal laser scanning (CLSM ...
-
bioRxiv - Immunology 2023Quote: ... The membrane was then washed 3 times with TBS-T and 2 times in TBS and developed using SuperSignal West Pico PLUS Chemiluminescence reagent (ThermoFisher). The resulting membrane was imaged on a BioRad ChemiDoc system and visualized using Image Lab software (BioRad) ...
-
bioRxiv - Molecular Biology 2023Quote: ... hESCs were differentiated into cardiac mesoderm by culturing for 3 days in RPMI B27-medium (RPMI 1640 GlutaMAX + 2% B27 supplement minus insulin (ThermoFisher), 200 μM L-ascorbic acid (Sigma) ...
-
bioRxiv - Cell Biology 2023Quote: ... induction medium was replaced every 2-3 days by mature medium containing StemPro-34 SF medium (Gibco, Thermo Fisher Scientific), GlutaMAX (10 μl/ml ...
-
bioRxiv - Molecular Biology 2024Quote: ... MEFs and HeLa) or 2 µL of Lipofectamine 2000 (Calu-3 and VeroE6) according to the manufacturer’s recommendation (ThermoFisher and Invitrogen, respectively). For co-transfections ...
-
bioRxiv - Bioengineering 2024Quote: ... and fresh media was added and incubated for a further 24 hours before performing the viability assay using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Thermo Fisher Scientific). The media was replaced with fresh cell culture media containing MTT (0.25 mg/mL ...
-
bioRxiv - Developmental Biology 2024Quote: ... cell vials were thawed 2-3 min in a 37°C water bath and transferred in T25 cell culture flasks (Gibco) with 5ml of hASC culture medium containing Minimum Essential Mediun (αMEM ...
-
bioRxiv - Genetics 2024Quote: ... The coverslips were then dried for 2-3 min and mounted on clean slides using Prolong Gold AntiFade (Life Technologies). Nikon confocal laser scanning microscope C2 TIRF was used to take images of the cells ...
-
bioRxiv - Microbiology 2024Quote: ... the PBS or virus dilution in PBS was aspirated and 3 ml of overlay consisting of 1:1 2 x DMEM (DMEM high glucose, no sodium bicarbonate buffer powder [Gibco # 12-100-046] in 500 mL of RNase-free water ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were washed 3×2 minutes with DPBS before a permeabilization solution (0.1% Triton-X (Fisher Scientific, 9002-93-1) in DPBS ...
-
bioRxiv - Neuroscience 2024Quote: Duplex of the MEF2C enhancer sequence containing a mutation site [5′-ATGTATTTTTCTGCAATAAGT-3′ (×2)] in human genomic DNA were synthesized (Invitrogen). Additionally ...
-
bioRxiv - Bioengineering 2024Quote: ... 2.08 x 102 ng/cm2 of pDNA was mixed with the 2 μL p3000 reagent per μg DNA then combined with 3 μL/μg Lipofectamine 3000 (Invitrogen) and incubated for 15 minutes before adding over cells ...
-
bioRxiv - Immunology 2024Quote: ... the samples were rinsed with PBS 2-3 times and mounted with ProLong Gold antifade reagent containing DAPI (Life Technologies). The samples were then visualized using a Zeiss LSM 880 Confocal Laser Scanning Microscope ...
-
bioRxiv - Developmental Biology 2024Quote: ... Slides were then incubated for 1 hour in 2-3 drops per slide of HRP-conjugated streptavidin (Alexa Fluor 594 Tyramide Superboost Kit, Invitrogen), washed 3 times for 10 minutes each in 1x PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... the final transfection mixture contained 3 μL of lipofectamine with 2 μg of total plasmid DNA in 200 μL OptiMEM (31985070, Gibco). The transfection mix was incubated for 20 min at room temperature before adding to seeded HEK cells (confluency ∼ 60-70% ...
-
bioRxiv - Bioengineering 2024Quote: ... and primers (Eurofins Scientific, France) at the specified melting temperature (Tm) (Table 2) using a QuantStudio 3 (Thermo Fisher Scientific) thermocycler ...
-
bioRxiv - Biochemistry 2024Quote: ... the degree of labelling was compared to hydrolysed succinimidyl 3-(2-pyridyldithio)propionate (SPDP, 0.3 kDa vs. 2.7 kDa, ThermoFisher, UK, #21857). To appraise the percentage labelling the fluorescent signals from the chased samples were calibrated against F-MAL standards ...
-
bioRxiv - Molecular Biology 2021Quote: ... the input aliquot (100 µl) was mixed with equal volume of 2× protein sample buffer (2× NuPAGE LDS buffer [Life Technologies], 100 mM DTT, 4% [w/v] SDS) and the IP with 100μl 1 x protein sample buffer followed by incubation for 10 min at 75 °C ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were mounted on ProLong Gold with 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, Waltham, MA, USA) and imaged using a Delta-Vision II microscope system with an Olympus IX-71 inverted microscope using a 100x objective A ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 x 105 – 4 x 105 mESCs were cultured in 60mm Petri dishes in DFNB medium (Neurobasal medium/Gibco, DMEM F12 1:1/Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... Fluorescent indicators (fluo-4 AM, fura-2 AM, fura-FF AM) were purchased from Molecular Probes (Thermo Fisher Scientific). NMDA was from Merck Millipore ...
-
bioRxiv - Molecular Biology 2020Quote: ... were resolved on precast NuPAGE 4-12% Bis-Tris midi 12+2-well protein gels (cat. no. WG1401BOX, Invitrogen) at 200 V for 40 min in NuPAGE 2-(N-morpholino)ethanesulfonic acid (MES ...
-
bioRxiv - Molecular Biology 2020Quote: ... Slides were mounted in ProLong™ Gold Antifade Mountant containing 4’,6’-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific). Images were acquired at 100x magnification using a Nikon Eclipse Ti fluorescence microscope fitted with a Hamamatsu C11440 digital camera ...
-
bioRxiv - Microbiology 2020Quote: ... Finally samples were counter stained for nucleus with 1 μM DAPI (4′, 6-diamidino-2′-phenylindoldihydrochloride; Thermo Fisher Scientific). Zeiss inverted Axio Observer fluorescent microscope (Zeiss ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole and were embedded with ProLong Gold mounting medium (Life Technologies). ImageJ/Fiji software (National Institutes of Health ...
-
bioRxiv - Neuroscience 2020Quote: Human sections were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) and coverslips were mounted using Prolong Gold (Invitrogen) for imaging ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were mounted in ProLong Gold antifade reagent supplemented with 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes). Conventional immunocytochemical staining was done to quantify the activated PAK1 and actin in oAβ and IPA-3 treated cells using phospho-PAK1 (Thr423)/PAK2 (Thr402 ...
-
bioRxiv - Systems Biology 2021Quote: ... Fat and lower dermis was cut away and discarded before dispase (2 U/ml, Gibco, UK, 20h, +4°C) digestion ...