Labshake search
Citations for Thermo Fisher :
1701 - 1750 of 10000+ citations for 2H Pyrazolo 4 3 c pyridine 3 chloro 4 5 6 7 tetrahydro since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Cells were centrifuged at 300 x g for 5 min at 4°C and treated with 1 mL of Ammonium-Chloride-Potassium (ACK) Lysing Buffer (Gibco; cat#A1049201). After 2 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... 1% Triton X-100 and 5% goat serum and incubated overnight at 4°C and DNA was labeled using Hoechst (Thermo Fisher, H3570). Images were subsequently captured with confocal microscope ...
-
bioRxiv - Plant Biology 2024Quote: ... Lysates were cleared by centrifugation at (21,000 g, 5 min, 4 °C) and endogenous metabolites were removed with Zeba Spin Desalting Columns (ThermoFisher, cat. no 89882). The lysate was then split into sample replicates for PISA (four replicates for each treatment) ...
-
bioRxiv - Cell Biology 2024Quote: ... the grids were blotted for 3.5 s at a humidity of 100% and 4°C and plunge-frozen in liquid ethane using a Vitrobot (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2023Quote: ... The cell suspension was then centrifuged at 300 × g for 5 min at 4 °C and cells resuspended in 100 µL of stain buffer (BD Biosciences, supplemented with 5 mM EDTA (Thermo Fisher Scientific)) ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell suspensions were centrifuged at 400 g for 5 min at 4 °C with no brake and resuspended in staining buffer (DPBS (without Ca2+ and Mg2+) (Gibco, Life Technologies) containing 0.1 % low endotoxin BSA (Sigma) ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were boiled at 95°C for 5 min and 10 µl of each sample was separated by 4-12% Bis-Tris SDS-PAGE (Thermo Scientific NW04122BOX) in 1×MES buffer (Thermo Scientific B0002 ...
-
bioRxiv - Cell Biology 2023Quote: ... Lysates were cleared by centrifuging at 12.000 rpm for 5 min at 4°C and protein concentration determined using the Pierce™ BCA Protein Assay (Thermo Scientific 23225). Samples were prepared for SDS-Page in 1× NuPAGE™ LDS Sample Buffer containing 50mM DTT ...
-
bioRxiv - Genomics 2023Quote: Adults were relaxed by incubating for 3–16 hours at 4 °C in about 400 mL ASW with approximately 5 g of 99% L-menthol crystals (Thermo Scientific A10474) (3 adults per 400 mL volume) ...
-
bioRxiv - Bioengineering 2023Quote: ... All samples were heated at 99 °C for 5 min and separated using Novex Precast 4–20% gels (Invitrogen, Waltham, MA, #WXP42020BOX) in SDS-PAGE ...
-
bioRxiv - Molecular Biology 2023Quote: ... beads were washed five times with RIP buffer for 5 min at 4°C and RNA was extracted using TRIzol (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reduced samples (by addition of 2-mercaptoethanol) were heated at 95°C for 5 minutes then loaded onto a 4-12% tris-glycine gradient gel (Thermo Fisher, XP04122BOX) and ran at 125 volts for 1-1.5 hours ...
-
bioRxiv - Bioengineering 2024Quote: ... Samples were then boiled at 95°C for 5 min and electrophoresed using a NuPAGE Bis-Tris Gel (4-12%) with NuPAGE SDS Running Buffer (Thermo Fisher Scientific) for 2 hr at 130 V ...
-
bioRxiv - Genomics 2024Quote: ... The membrane was blocked with 5% non-fat milk for 1 hour at RT and incubated overnight at 4°C with primary antibody [Sfrp1 (Invitrogen, MA5-38193), Nr3c1 (Cell signaling ...
-
bioRxiv - Genetics 2024Quote: ... Samples were denatured at 99°C for 5 minutes and separated on a 4-20% tris-glycine protein gel (Thermo Fisher Scientific) at 150 V for 75 minutes ...
-
bioRxiv - Neuroscience 2024Quote: ... The samples were then heated at 95°C for 5 minutes before loading on to the Bolt 4-12% BisTris Gel (Thermo Fisher Scientific). After electrophoresis ...
-
bioRxiv - Molecular Biology 2024Quote: ... 200 μl of cells were collected by centrifugation at 1500 rpm for 5 min at 4°C and stained with anti-SARS-CoV-2 RBD antibody (Invitrogen, PA5-114529). After centrifugation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Membranes were incubated overnight (50 rpm, 4°C) with either mouse anti-His monoclonal (Thermo Fisher; 1:3000 in 5% skimmed milk) or anti-IFNa2 primary antibody (abcam ...
-
bioRxiv - Biochemistry 2024Quote: ... Four μl of sample with an OD260 of 7.5 were applied to the grids and vitrified at 4 °C and 100 % humidity using a Vitrobot Mk IV (Thermo Fisher Scientific) (blot 6s ...
-
bioRxiv - Bioengineering 2024Quote: ... The cell suspension was then filtered through a 70um cell strainer and pelleted at 400 xG for 5 min at 4°C followed by RBC lysis using ACK lysis buffer (Gibco A10492-01) for 5 min on ice ...
-
bioRxiv - Cell Biology 2024Quote: ... The membranes were immunoblotted at 4°C overnight with the following antibodies in 5% BSA/1x TBST: MKP1/DUSP1 (1:1000, Invitrogen #MA5-32480), DUSP3 (1:2000 ...
-
bioRxiv - Biochemistry 2024Quote: Purified MglAGDP and MglB were labeled overnight at 4°C under gentle agitation in the presence of a 5-fold excess of Alexa Fluor™ 488 C5-maleimide (ThermoFisher scientific) or Janelia Fluor® 646 Maleimide (TOCRIS ...
-
Loss of TMEM55B modulates lipid metabolism through dysregulated lipophagy and mitochondrial functionbioRxiv - Cell Biology 2024Quote: ... Samples were eluted with Laemmli buffer and denatured at 95°C for 5 min before loading to 8% or 4-20% Tris-Glycine gels (Thermo Fisher Scientific). After transferring ...
-
bioRxiv - Developmental Biology 2024Quote: ... Around 1% of the sample was set aside as input and the remaining supernatant was incubated overnight at 4°C with 5 µg of anti-CtBP2 antibody (Invitrogen, PA5-86439), anti-HDAC1 antibody (Diagenode ...
-
bioRxiv - Cell Biology 2024Quote: Cells (2 – 5 x 106) were washed two times with cold PBS and lysed with RIPA buffer at 4°C (Thermo Fisher Scientific) supplemented with protease inhibitor (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... cells were incubated for 30 min at 4°C with 5 μM of MitoSOX and 100 μM of MitoTracker (Thermo Fisher Scientific) to assess mitochondrial superoxide production and mitochondrial mass ...
-
bioRxiv - Bioengineering 2021Quote: ... Apoptosis was detected by incubating devices with 5μM of CellEvent™Caspase 3/7 Green detection reagent (Invitrogen) for 30 minutes at 37°C.
-
bioRxiv - Cancer Biology 2021Quote: ... After 3 and 7 days of treatment cells were stained with 2% crystal violet (CV) (40583100, Acros Organics, Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... Samples were incubated for 30 min in standard media with CellEvent Caspase 3/7 (1:400, C10423, Invitrogen) prior to imaging to observe apoptosis.
-
bioRxiv - Immunology 2020Quote: ... splenic NP366-374 TMEM were assessed with CellEvent™ Caspase-3/7 Green Flow Cytometry Assay kit (ThermoFisher). Lung single cells were stained with surface markers then incubated with caspase 3/7 green detection reagent for 30 minutes at 37°C as described in the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were loaded with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions for kinetic assays and fluorescence in the live cells ...
-
bioRxiv - Cell Biology 2022Quote: Live/Dead™ Cell Imaging Kit and CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) were used for detection of cell apoptosis based on the manufacturer instructions ...
-
bioRxiv - Immunology 2023Quote: ... 10% H2/N2 (BOC) for 3 days on blood agar plates containing 7% laked horse blood (Thermo Scientific) and the Campylobacter selective supplement “Skirrow” containing the antibiotics trimethoprim ...
-
bioRxiv - Neuroscience 2022Quote: ... The final pellet was resuspended in 0.5 mL of NRB containing 6 μM 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher; D1306). The suspension was filtered through a 20 μm filter (Sysmex ...
-
bioRxiv - Microbiology 2022Quote: 293T-ACE2 and HT1080-ACE2 cells were seeded in 24-well plates and 6-well plates respectively to achieve 70% confluency after 4-6 hours and then transfected with Lipofectamine RNAiMAX (Thermofisher) using the indicated dsiRNAs (IDT ...
-
bioRxiv - Genetics 2021Quote: ... 72°C 13:30 min and hold at 4°C in a Veriti Thermal Cycler (Applied Biosystems). The PCR products were purified with 3 μl Exo/SAP and then cycle-sequenced with the BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... niveus CO7 DNA ranging from 7 to 7 × 10−4 ng/µl was generated and quantified using a Nanodrop-8000 Spectrophotometer (Thermo Scientific, Wilmington DE, USA) (260/280 ratio of 1.89) ...
-
bioRxiv - Neuroscience 2021Quote: ... in Tris-buffered PBS/ 0.1 % Tween 20 for 1 h at room temperature they were incubated overnight at 4 °C with the following antibodies: rabbit polyclonal anti-2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase; 49 kDa; 1:1000; Thermo Fisher Scientific, Waltham, MA, USA), mouse monoclonal anti-myelin-associated glycoprotein (MAG ...
-
bioRxiv - Cell Biology 2023Quote: siRNA probes targeting sfrp2 in human mesenchymal cells and frizzled-5 and -6 in AEC2 cells were obtained from Thermo Fisher (Supplemental Table 4). In brief ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... pseudonana expressing VHAB-eGFP were incubated with the acidotropic pH stain 2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-aminocarbamoyl)methoxy)phenyl)oxazole (PDMPO) (LysoSensor YellowBlue DND-160; Life Technologies) at a final concentration of 0.125 μM without washing in F/2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... (4) 30 min incubation in ammonium chloride (NH4Cl) and (5) 4 min incubation in Tissue Autofluorescence Quenching Kit (ReadyProbes, ThermoFisher Scientific).Secondary antibodies were used as follows ...
-
bioRxiv - Biochemistry 2023Quote: ... NaHCO3 and 150 μL acetone containing 4 mg/mL 1-fluoro-2-4-dinitrophenyl-5-L-alanine amide (L-FDAA, Thermo Scientific) was added ...
-
bioRxiv - Cell Biology 2022Quote: MUTZ-3 cells (DSMZ) were cultured at 37°C in alpha-MEM (Life Technologies) supplemented with 20% FBS ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μg of mammalian expression vector plasmids based on pEF1α V5 His C (Invitrogen) encoding codon-optimized gH ...
-
bioRxiv - Bioengineering 2024Quote: ... cells were fed 3% vessel volume 1x Efficient Feed C+ (Thermo Fisher Cat. # A2503101) (split into 3 separate boluses ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Molecular Biology 2021Quote: ... and CAF-1 p60 (5′-AAUCUUGCUCGUCAUACCA-3′) were transfected using RNAi MAX (Invitrogen).
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...