Labshake search
Citations for Thermo Fisher :
1651 - 1700 of 10000+ citations for Recombinant Mouse Tnfrsf17 Fc His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 ng/mL human EGF recombinant protein (Life Technologies, Cat: PHG0311), and 100 IU/mL P/S ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... VEGF ligand (recombinant human protein) was ordered from ThermoFisher (CAT: #PHC9391).
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Immunology 2024Quote: ... injections also contained 1 μg of recombinant murine IL-2 (Gibco). PBS was used as vehicle.
-
bioRxiv - Immunology 2024Quote: ... used for recombinant protein production were maintained in FreeStyle (ThermoFisher, #12338026) or Expi293 media (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Staining with DYKDDDDK Tag Recombinant Rabbit Monoclonal Antibody (8H8L17, Invitrogen, 701629) at 1:500 dilution was performed in blocking solution at 4℃ for 14 hours ...
-
bioRxiv - Microbiology 2024Quote: ... Treatment with recombinant 10 U/mL human IFNγ (ThermoFisher Scientific RIFNG100) was done at 24 hours post-infection ...
-
bioRxiv - Bioengineering 2024Quote: ... 5250 ng/mL human recombinant IL-6 protein (Invitrogen; Waltham, MA) was added to the experimental group and an equal volume of 1X PBS was added to the control group ...
-
bioRxiv - Synthetic Biology 2023Quote: All recombinant proteins were produced in Expi293F cells (Thermo Fisher Scientific) by transient transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant murine pro-CtsK were expressed in 293-Freestyle cells (ThermoFisher) by transient expression using FectoPRO transfection reagent (Polyplus transfection) ...
-
bioRxiv - Biophysics 2024Quote: ... The recombinant DR2539 was expressed in Escherichia coli BL21 (DE3) (Invitrogen). The cells were grown at 310 K to an OD600 of ≈ 0.6 in Luria-Bertani medium containing 100 µg ml-1 of ampicillin ...
-
bioRxiv - Immunology 2024Quote: ... Recombinant proteins were diluted in DPBS (Life technologies cat. # 14040-182) (tetNA was diluted to 0.5 µg/ml) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... All ACE2-Fc constructs were produced in Expi293F cells (Thermo Fisher A14527) in Gibco Expi293 Expression Medium at 37°C in a humidified 8% CO2 incubator rotating at 130 rpm ...
-
bioRxiv - Genomics 2022Quote: ... and staining was performed in the presence of Fc block (eBioscience/ThermoFisher, True-Stain Monocyte Blocker (Biolegend) ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were blocked with Fc block (CD16/32, Invitrogen, 14-0161-82) for 20 minutes on ice ...
-
bioRxiv - Molecular Biology 2019Quote: ... and aliquots were incubated with Fc Block (ThermoFisher Scientific 14-9161-71) 20 minutes at 4°C ...
-
bioRxiv - Immunology 2019Quote: ... containing 10% FCS (PAA) and 1% Penicillin-Streptomycin-Glutamine (Thermo Fisher Scientific). Medium was exchanged after 3 hours and cells were stimulated.
-
bioRxiv - Genomics 2020Quote: ... washed twice in FC buffer and resuspended in Sytox Blue (Thermo Scientific) containing FC buffer for live/dead discrimination according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... supplemented with 1% penicillin-streptomycin and 10% fetal calf serum (FCS, Gibco) in an incubator (37°C ...
-
bioRxiv - Biophysics 2021Quote: ... while HRP-conjugated anti-human IgG Fc (Invitrogen™, Waltham, MA, USA) diluted 1:10,000 in PBS was used in wells treated with REGN10987 ...
-
bioRxiv - Neuroscience 2021Quote: ... Monocytes were immersed in 45% fetal calf serum (FCS, 10500 ThermoFisher Scientific), and 10% dimethyl sulfoxide (DMSO ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 10% (v/v) fetal calf serum (FCS, Thermo Fisher Scientific) and 1% (v/v ...
-
bioRxiv - Cancer Biology 2020Quote: ... LAIR-1 Fc was biotinylated with EZ-Link NHS-PEG4-Biotin (ThermoFisher), No-Weight Format (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... FCS and L-Glutamine were all purchased from Gibco (Thermo Fisher Scientific). The following chemicals were obtained from Roth ...
-
bioRxiv - Biophysics 2020Quote: ... supplemented with 10% FCS (Eurobio) and 1% Non-Essential Amino Acids (Gibco). Primary astrocytes were obtained from E17 rat embryos following (Etienne-Manneville ...
-
bioRxiv - Biochemistry 2021Quote: ... labeled with 50 µL Goat anti-Human IgG Fc PE conjugate (ThermoFisher Scientific Invitrogen Catalog # 12-4998-82 ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 10% fetal calf serum (FCS; ThermoFisher, 10499044 [Lot Number 08G8293K]) at 37°C with 5% CO2 ...
-
SIMON, an automated machine learning system reveals immune signatures of influenza vaccine responsesbioRxiv - Immunology 2019Quote: ... filtered through 0.1um spin filter with 20uL/sample of Fc block (ThermoFisher) for 30min at 4°C ...
-
bioRxiv - Cancer Biology 2020Quote: ... in MLNL medium (low-glucose DMEM/1% FCS, Thermo Fisher Scientific 21885025). At day 2 ...
-
bioRxiv - Physiology 2019Quote: ... On day 0 media was additionally supplemented with 10% FCS (Gibco#10270106). The hPCLS were treated with 10ng/ml recombinant human TGFß 1 protein (R&DSystems#240-B-010 ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 10% v/v (FCS) and 2 mM L-glutamine (Gibco). Where indicated ...
-
bioRxiv - Immunology 2020Quote: ... and optical densities were acquired with a Multiskan™FC (Thermo Scientific).
-
bioRxiv - Immunology 2020Quote: ... after which staining was inhibited by adding 10% FCS (10270-106, Gibco). Stained cells were washed in RPMI/PS prior to counting and addition to macrophages ...
-
bioRxiv - Molecular Biology 2021Quote: ... These cells were cultured in DMEM containing 10% FCS (Thermo Fisher Scientific) and 1% penicillin-streptomycin (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... Absorbance was measured at 405 nm using a Multiskan FC (Thermo Scientific).
-
bioRxiv - Immunology 2021Quote: ... for 2h at RT on a Multiscan FC Plate Reader (Thermo Scientific) at medium shaking speed ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 10% FCS and 1% penicillin/streptomycin (#P433, Thermo Fisher Scientific) at 37°C and 5% CO2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... HRP-goat anti-human IgG Fc secondary antibody (A18817, Thermo Fisher Scientific) was used ...
-
bioRxiv - Cancer Biology 2022Quote: ... and HCC70 were cultured in an RPMI medium containing 10% FCS (Gibco), 2 mM glutamine ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 10% foetal calf serum (FCS) (Thermo Fisher Scientific: 10902-096) and 100U/ml of each penicillin and streptomycin (P/S ...
-
bioRxiv - Immunology 2022Quote: ... Culture supernatant was then incubated with CaptureSelect IgG-Fc resin (Thermo Scientific) and eluted from the resin using 0.1 M glycine ...
-
bioRxiv - Immunology 2022Quote: ... at 106cells/mL in complete RPMI medium supplemented with 10% FCS (Gibco), 50 μM 2-mercaptoethanol ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 10% heat inactivated fetal calf serum (FCS, Thermo Fisher, USA), 50 U/mL of penicillin (Ozyme ...
-
bioRxiv - Microbiology 2022Quote: ... from Gibco supplemented with 10% heat inactivated fetal calf serum (FCS, Thermo Fisher, USA), 50 U/mL of penicillin (Ozyme ...