Labshake search
Citations for Thermo Fisher :
1651 - 1700 of 4028 citations for Influenza Virus Hemagglutinin HA H7N9 Fc tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... Tandem mass tag (TMT) ten-plex reagents (0.2 mg) (Thermo Fisher Scientific, Waltham, MA) were removed from −20 °C and allowed to reach room temperature prior to dissolving each tag in 20 µL of acetonitrile ...
-
bioRxiv - Pathology 2021Quote: ... 0.1 % Tween20) and incubated with antibodies specific for V5 tag (ThermoFisher Scientific, MA, USA), PBX1 (Abnova ...
-
bioRxiv - Microbiology 2019Quote: Qst was fused to a His-tag using the pEXP5-CT/TOPO vector (Invitrogen) following the TA-cloning protocol provided by the manufacturer ...
-
bioRxiv - Biochemistry 2020Quote: ... Nanobody binding was detected using Myc-tag specific antibody (2 μg/ml – Life Technologies) and then anti-mouse-Alexa Fluor 700 (1.3 μg/ml – Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 μg aliquots were next labeled using tandem mass tags (TMT) (Thermo Scientific, 90309). Dried peptides were resuspended in a solution of 30% dry acetonitrile (ACN ...
-
bioRxiv - Genetics 2021Quote: ... Myc-Tag or PCNA signal was detected using SuperSignal West Femto (Thermo Fisher Scientific) or Clarity (Bio-Rad ...
-
bioRxiv - Molecular Biology 2020Quote: ... The V5 epitope tag was detected by using mouse monoclonal anti-V5 antibody (Invitrogen) at 1 ug/ml ...
-
bioRxiv - Immunology 2022Quote: ... the CaptureSelect™ Alexa Fluor™ 488 anti-C-tag conjugate (Thermo Fisher Scientific) was added to the cell supernatant at a final dilution of 1:480 ...
-
bioRxiv - Microbiology 2022Quote: Pull-down assays were carried out using Dynabeads His-tag Isolation and Pulldown (Invitrogen). The 6His-tagged soluble pilin domains were used as bait ...
-
bioRxiv - Plant Biology 2022Quote: ... and purified by Dynabeads™ His-Tag Isolation and Pulldown (ThermoFisher, Catalog number 10103D). DA1 swapped protein ubiquitylation reactions used E1 ...
-
bioRxiv - Microbiology 2022Quote: ... Unbound biotin or SULFO-TAG was removed using Zeba spin desalting columns (ThermoFisher Scientific), and the incorporation ratio for each label was measured (See Dataverse file) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and probed with 6x-His Tag Monoclonal Antibody (HIS.H8) (Thermo Fisher Scientific #MA1-21315) diluted in 5% milk in PBS-T (1:500) ...
-
bioRxiv - Neuroscience 2022Quote: ... streptavidin conjugated to an Alexa Fluor™ (AF) fluorescent tag (1:400; Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Isobaric labeling was performed using Tandem Mass Tag (TMTpro 16plex) reagents (Thermo Fisher Scientific). Labelled samples were combined into one pooled TMT set ...
-
bioRxiv - Cancer Biology 2023Quote: ... Flag-tag primer is GATTACAAGGATGACGACGATAAG) for 36 hours in Opti-MEM (31985062, Thermo Fisher) medium with 10 µL GeneTran III reagent (GT2211 ...
-
bioRxiv - Biochemistry 2023Quote: ... or 1:6000 for a mouse monoclonal antibody against V5 tag (R960-25; Invitrogen) to detect V5tagged ANGPTL4 ...
-
bioRxiv - Plant Biology 2023Quote: ... The GST tag was removed using PreScission Protease (Thermo Fisher Scientific, Cat. No. 88946). The His-ZmTPL2N-His recombinant protein was purified using Pierce Ni-NTA resin (QIAGEN ...
-
bioRxiv - Microbiology 2023Quote: ... a His6 tag for affinity purification using Ni-NTA Agarose Beads (Thermo Scientific Pierce). Full-length antibodies were purified using protein A agarose beads (Thermo Scientific Pierce) ...
-
bioRxiv - Biochemistry 2023Quote: ... Individual samples were then labeled with isobaric tags using commercially available TMTsixplex (ThermoFisher, 90061) kits ...
-
bioRxiv - Cell Biology 2023Quote: ... The following antibodies and reagents were used: anti-V5 tag (Invitrogen, 1:1000 dilution), anti-PLIN1 (Cell Signaling Technology ...
-
bioRxiv - Immunology 2022Quote: Antigen proteins with hexahistidine tags were purified with HisPurTM Ni-NTA resin (Thermo Fisher). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... 1:5000 and mouse anti-His6 tag polyclonal antibodies (Thermo Fisher, cat# 37-2900) 1:1,000 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... each labeled with a unique fluorescent tag (e.g., FAM, VIC, NED, PET; Applied Biosystems) to co-amplify multiple loci ...
-
bioRxiv - Biophysics 2023Quote: ... diluted at 1:5000 and mouse monoclonal anti-V5 tag (Thermo Fisher, #R960-25) diluted at 1:5000 for blotting.
-
bioRxiv - Bioengineering 2023Quote: ... MCF7 cells were transiently transfected with Premo FUCCI cell cycle sensor tags (Thermofisher, USA). MCF7 cells required additional treatment with BacMam enhancer (Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... The proteins were purified via CaptureSelect™ C-tag affinity matrix (Thermo Fisher Scientific). A further SEC polishing step was performed on a HiLoad 16/600 Superdex 200 pg column (GE Healthcare ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We then used the Dynabeads His-Tag Isolation and Pull- down kit (ThermoFisher 10103D) to isolate his-tagged Fcy1 following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Supernatant was then processed through a His-tag cobalt resin (ThermoFisher, Waltham, MA, USA) following manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... grown in 12-well plates in DMEM supplemented with 10% FCS (Gibco-BRL) and glutamine ...
-
bioRxiv - Microbiology 2022Quote: ... Nb fused with Fc was purified using Protein G (cat.# 20399, Thermo Scientific).
-
bioRxiv - Molecular Biology 2021Quote: ... Opti-MEM and fetal calf serum (FCS) were from GIBCO (Waltham, MA, USA). All cell culture ware was purchased from BD Falcon (Corning ...
-
bioRxiv - Immunology 2019Quote: ... supplemented with 10% FCS (PAA) and 1% Penicillin-Streptomycin-Glutamine (Thermo Fisher Scientific), 50µM β-mercaptoethanol (Sigma) ...
-
bioRxiv - Immunology 2019Quote: ... Cell pellets were resuspended in FACS buffer (5% FCS in PBS, Life Technologies). After adding Fcγ receptor block (1:100 dilution ...
-
bioRxiv - Genomics 2019Quote: A375 cells were grown in DMEM + 10% FCS + Penicillin/streptomycin (Gibco, Carlsbad, MA) and were treated with 10,000 J/m2 UVB 310 nm (7 mins @ 25 J/m2/s ...
-
bioRxiv - Genetics 2020Quote: ... with a final quench in PBS + 2% fetal calf serum (FCS, Invitrogen 26140079). Cells were permeabilized for 5 minutes with saponin buffer (PBS + 0.2% Saponin (Sigma S7900 ...
-
bioRxiv - Bioengineering 2021Quote: ... supplemented with 10% fetal calf serum (FCS) and 1% PenStrep (Thermo Fisher Scientific).
-
bioRxiv - Bioengineering 2021Quote: ... supplemented with 10% fetal calf serum (FCS) and 1% PenStrep (Thermo Fisher Scientific). Imaging was performed in a heating chamber preheated to 37 °C and placed on an inverted microscope (IX83 from Olympus ...
-
bioRxiv - Systems Biology 2020Quote: ... PHHs were cultivated in Williams medium E (Biochrom) supplemented with 10% FCS (Gibco), 100 nM dexamethasone ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 10 % V/V heat inactivated Fetal Calf Serum (Hi FCS, Gibco), 1 mM sodium pyruvate (Gibco ...
-
bioRxiv - Molecular Biology 2021Quote: ... All media were supplemented with 10% fetal bovine serum (FCS, Biochrom or GIBCO), 100 U/ml of penicillin and 0.1 mg/ml of streptomycin (PAN-Biotech) ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 10% FCS and 1% Non-essential amino acids (Thermo Fisher #11140050)) ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 15% fetal calf serum (FCS) and 2 mM Gln (ThermoFisher Scientific) at 37°C in 1% CO2 ...
-
bioRxiv - Cell Biology 2021Quote: ... washed in sterile Schneider’s medium containing 20% fetal calf serum (Schneider’s/FCS; Gibco), and eventually homogenized with micro-pestles in 1.5 centrifuge tubes containing 21 embryos per 100 μl dispersion medium (Prokop et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... supplemented with 10% heat-inactivated FCS (Interpath services) and 2mM L-glutamine (Invitrogen) at 37°C ...
-
bioRxiv - Neuroscience 2022Quote: ... Brain leukocytes were washed and blocked with mouse Fc Block (ThermoFisher, clone 93) prior to staining with primary antibody-conjugated flourophores ...
-
bioRxiv - Immunology 2020Quote: ... 2.5% FCS and 100 IU/ml penicillin and 100 mg/ml streptomycin (Gibco). CD4+ T cells were isolated from PBMC using CD4+ T cell isolation kit (Miltenyi Biotec ...
-
bioRxiv - Microbiology 2021Quote: ... Colorimetric changes were measured using an ELISA microplate reader (MULTISKAN FC, Thermo Scientific) at 450 nm ...
-
bioRxiv - Molecular Biology 2020Quote: ... Opti-MEM and fetal Calf serum (FCS) were from GIBCO (Waltham, MA, USA). All cell culture ware was purchased from BD Falcon (Corning ...
-
bioRxiv - Immunology 2020Quote: ... incubated in RPMI containing 10% FCS and 0.2 mg/ml Collagenase IV (GIBCO) for 30 min and then passed through a 19G needle to obtain a homogenous cell suspension ...
-
bioRxiv - Immunology 2021Quote: ... Lonza) with 10% fetal calf serum (FCS) with low LPS (HyClone, Thermo Scientific) and 10% conditioned L929 media as a source of CSF-1 ...