Labshake search
Citations for Thermo Fisher :
1651 - 1700 of 10000+ citations for 3 Thiophen 3 yl benzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... 3 µg of RNA were treated with TurboDNase (Fisher Scientific) and reverse transcribed using M-MLV Reverse Transcriptase (Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher) was added and apoptotic cells were detected with Leica DMi8 fluorescence microscope (Leica Microsystems ...
-
bioRxiv - Biochemistry 2024Quote: Pierce RNA 3’ End Biotinylation Kit (ThermoFisher, cat. no. 20160) was used to label the 3’ end of 200-bp ...
-
bioRxiv - Cell Biology 2024Quote: ... on the QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Amplification data were analyzed within the QuantStudio software package with the ΔΔCt method with Gapdh as a reference gene and normalized as relative fold expression to freshly isolated glomeruli (day 0) ...
-
bioRxiv - Cell Biology 2024Quote: ... washed 3 times with PBS and exposed to film (ThermoFisher) using a horseradish peroxidase (HRP ...
-
bioRxiv - Cancer Biology 2024Quote: ... digested in DMEM containing 3 mg/mL Dispase II (Gibco) and 1 mg/mL Collagenase IV (C5138;Sigma ...
-
bioRxiv - Cancer Biology 2024Quote: ... and blocking was done with 3% BSA (Thermo Fisher Scientific) for 1h ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the QuantStudio 3 Real-Time PCR System (Applied Biosystems). Primer sequences were following:
-
bioRxiv - Cancer Biology 2024Quote: ... and the QuantStudio 3 Real-Time PCR System (Applied Biosystems). Each reaction was performed in triplicate and consisted of 33 ng of cDNA ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were selected on 3 μg/ml blasticidin (Gibco, A1113903) for 3 days ...
-
bioRxiv - Developmental Biology 2024Quote: ... with 3% w/v bovine serum albumin (BSA, AlbuMax, GIBCO) for 30 min at 37°C ...
-
bioRxiv - Developmental Biology 2024Quote: ... containing 3% w/v bovine serum albumin (BSA, AlbuMax, GIBCO) and under mineral oil (Irvine Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... qPCR was then carried out using QuantStudio 3 (Applied Biosystems) and Luna® Universal qPCR Master Mix (New England BioLabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... in a QuantStudio 3 Real-Time PCR System (Applied Biosystems). Primers used in this paper can be found in Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 million cells were washed twice with Opti-MEM (Gibco) and resuspended in 90 µl Opti-MEM with 10 µg of DNA in an electroporation cuvette with a 2 mm gap ...
-
bioRxiv - Neuroscience 2021Quote: ... in Tris-buffered PBS/ 0.1 % Tween 20 for 1 h at room temperature they were incubated overnight at 4 °C with the following antibodies: rabbit polyclonal anti-2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase; 49 kDa; 1:1000; Thermo Fisher Scientific, Waltham, MA, USA), mouse monoclonal anti-myelin-associated glycoprotein (MAG ...
-
bioRxiv - Biophysics 2022Quote: ... and 2-3 μL of the freshly phase-separated sample was placed into a chamber made on a glass slide (Fisher Scientific 3” × 1” × 1 mm). The chamber made by using double-sided tape was then sealed with a square coverslip to avoid evaporation of the sample ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Genetics 2021Quote: ... We then amplified and eif-3.G cDNA using primers for the SL1 trans-splice leader (YJ74) and eif-3.G isoform A 3′UTR (YJ11560) and Phusion polymerase (Thermo Fisher Scientific, San Diego, CA). The cDNA clones in PCR8 vector were then used to generate tissue-specific expression constructs using Gateway™ cloning destination vectors (pCZGY1091 for Punc-17β ...
-
bioRxiv - Cancer Biology 2020Quote: ... Red cells were removed by incubating the splenocytes for 3 minutes with 3 ml eBioscience™ 1X RBC Lysis Buffer (Invitrogen, ThermoFisher, #00-4333-57). Cells were pelleted by centrifugation ...
-
bioRxiv - Molecular Biology 2022Quote: 3′-RACE was used to determine the length of the mRNA 3′UTRs using the 3′RACE System for Rapid Amplification of cDNA Ends kit (Thermo Fisher Scientific, Carlsbad, CA, USA). Yeast total RNA used for steady-state and half-life northern blots was used to generate cDNA using SuperScript™II RT (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with following primary antibodies and/or labelling agents: anti-GFP (Invitrogen, #11122, 1:800, 3 days or Invitrogen, #10262, 1:800, 3 days), anti-V5 (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Microbiology 2024Quote: ... The 16S rRNA gene sequence was amplified with a DreamTaq polymerase using genomic DNA as the template and the primers 08F (5′-AGAGTTTGATCCTGGC-3′) and 1504R (5′-TACCTTGTTACGACTT-3′) following the standard instructions of the manufacturer (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was purified using the Master Pure Complete DNA & RNA Purification Kit (Epicentre ...
-
bioRxiv - Cell Biology 2024Quote: SYTL5 was amplified from WT U2OS cDNA (5’-ATGTCTAAGAACTCAGAGTTCATC-3’ and 5’-TTAGAGCCTACATTTTCCCATG-3’) and cloned into Zero Blunt TOPO vector using Zero Blunt™ TOPO™ PCR Cloning Kit (Thermo Fisher Scientific #450245) according to the manufactureŕs instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Beads were then washed 3 times for 3 min each with lysis buffer and RNA isolated after addition of 1 ml TRIZOL (Life Technologies cat. no. 15596-018). RNA isolated from 10% lysate was used as input ...
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...
-
bioRxiv - Plant Biology 2020Quote: ... and a precise concentration measurement with the Qubit 3 (Invitrogen, USA). The integrity of the RNA was confirmed via agarose gel electrophoresis.
-
bioRxiv - Biophysics 2021Quote: ... and 1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine (DiD) were from Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-TIM-3 clone F38.2E2 (ThermoFisher Scientific, catalog #16-3109-85) was used.
-
bioRxiv - Cancer Biology 2021Quote: ... cells were passaged every 3-4 days using Accutase (Life Technologies) and reseeded at 0.5×104 cells/mL on Geltrex-coated (Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: Quantitative PCR reactions were run on a QuantStudio 3 (Applied Biosystems) using the following program ...
-
bioRxiv - Cancer Biology 2021Quote: ... in 100 μl of 3% bovine serum albumin (BSA, Fisher Scientific) diluted in PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... resolved on a 3-8% Tris-Acetate SDS PAGE gel (Invitrogen), and transferred onto a PVDF membrane ...
-
bioRxiv - Cell Biology 2020Quote: ... the QuantStudio™ 3 Real-Time PCR System (ThermoFisher, cat# A28137) was used ...
-
bioRxiv - Cell Biology 2020Quote: ... in a 3:1 ratio with 1X penicillin/streptomycin (Gibco; 15070) and 5% FBS (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 and 9 μg respectively using Lipofectamine 2000 (Thermo Fisher, 11668027). Infectious supernatant was collected at 48 and 72 hours after transfection and filtered to remove cell debris ...
-
bioRxiv - Cell Biology 2020Quote: ... CDC20 was depleted using siRNA oligo #14 5’-CGGAAGACCUGCCGUUACA-3’ (ThermoFisher). siRNA oligos for PP2A-B55 and PP2A-B56 have been described (Hayward et al. ...
-
bioRxiv - Genetics 2021Quote: ... and qPCR was performed in a QuantStudio 3 instrument (Applied Biosystems).
-
bioRxiv - Microbiology 2021Quote: ... DMSO (3% v/v final conc.) and dNTPs (Thermo Scientific, #R0191). Twenty-nine PCR cycles were performed using the manufacturer’s protocol (annealing temperature ...
-
bioRxiv - Microbiology 2020Quote: ... RNA (∼3 µg) was treated with 2 units turbo-DNase (Invitrogen) in 1X turbo-DNase buffer for 30 min at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... Electrodes were labeled with DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine; Invitrogen) for postmortem reconstruction of their tracks in histologic sections ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3’ adenine overhangs were added (AmpliTaq DNA Polymerase Kit, Life Technologies). PCR amplification was performed via Kapa Hifi DNA Polymerase (Kapa Biosystems ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... DNA concentration was measured using a Qubit 3 fluorometer (ThermoFisher Scientific) with the dsDNA BR (Broad Range ...
-
bioRxiv - Developmental Biology 2020Quote: ... plus 3 μL lipofectamine RNAiMAX reagent (Thermo Fisher Scientific, cat. #13778075), following manufacturer protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative PCR (qPCR) was performed using QuantStudio 3 (Thermo Fisher, U.S.) following the MIQE guideline(Bustin et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... the NuPAGE™ 3 to 8% Tris-Acetate gels (Invitrogen, EA03755) were used with Tris-Acetate SDS Running Buffer (pH 8.24 ...
-
bioRxiv - Biophysics 2022Quote: ... 3 mL of CO2-independent α-MEM culture medium (Thermo Fisher) was pipetted on top of the samples ...
-
bioRxiv - Neuroscience 2021Quote: ... rat Taste receptor type 1 member 3 (Tas1r3, Rn00590759_g1, Applied Biosystems) and rat Taste receptor ...
-
bioRxiv - Neuroscience 2021Quote: ... in a Quant Studio 3 Real-Time PCR system (Thermo Fisher). Crossing threshold (Ct ...