Labshake search
Citations for Thermo Fisher :
1651 - 1700 of 10000+ citations for 2 4 Difluoro N 2 methoxy 5 4 4 morpholinyl 6 quinazolinyl 3 pyridinyl benzenesulfonamide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and MUTYH KO cells were obtained by infection of BJ FAP-TRF1 WT with lentivirus expressing respectively guide RNAs targeting OGG1 exon 4 (gRNA3, sequence GCTACGAGAGTCCTCATATG) and MUTYH exon 2 (gRNA5, sequence GCATGCTAAGAACAACAGTC) and selected with 1.5 µg/ml Puromycin (Gibco). OGG1 KO/MUTYH KO (DKO ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were passaged with 80-90% confluence at a split ratio of 1:2-1:4 using TrypLE (Gibco) for 8 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... The obtained cDNA was diluted to 2-4 ng/µl for subsequent qPCR with the Sybr Green (Applied Biosystems) method ...
-
The logic of native enhancer-promoter compatibility and cell-type-specific gene expression variationbioRxiv - Genomics 2022Quote: ... All cell lines were passaged regularly (every 2 to 4 days) with Accutase (PAA) or TrypLE (Thermo Fisher Scientific), and ESCs and EpiSCs were occasionally selected for Oct4 expression with 1µg/ml puromycin (Sigma) ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 µL RNase A/T1 Mix (4 µg RNase A, 10 U RNase T1, ThermoFisher Scientific, MA, USA) at 37°C for 30 min to remove host-originating nucleic acids ...
-
bioRxiv - Microbiology 2023Quote: ... 2 ug of EV protein content were separated on a 4-12% Bis-Tris gel (Thermo Scientific, Rockford, IL), then blotted onto a PVDF membrane ...
-
bioRxiv - Bioengineering 2022Quote: ... 4 μL of capture Ab (~4 μg/ml) or SARS-CoV-2 recombinant antigen (~0.2 mg/ml) in 1x PBS (Gibco) was loaded in each channel ...
-
bioRxiv - Cancer Biology 2022Quote: ... thinly sliced (1-2 mm) tissue samples were fixed overnight at 4°C in neutral-buffered formalin (Fisher Scientific) with PhosSTOP added (Roche) ...
-
bioRxiv - Developmental Biology 2022Quote: ... for 2 hours at 250mA and 4°C using cold transfer buffer (1.5x NuPAGE transfer buffer (Thermo Fisher Scientific), 10% methanol ...
-
bioRxiv - Cell Biology 2022Quote: ... or 2-well and 4-well chamber slides were transiently transfected with various cDNA constructs using Lipofectamine 2000 (Invitrogen) or FuGENE 6 (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... PCDH1 variants (sEC1-2 and sEC1-4) were generated by cloning the following sequences into the pcDNA3.1 mammalian expression vector (ThermoFisher): EC1-EC2 (residues 1-284 ...
-
bioRxiv - Neuroscience 2023Quote: ... and concentrated by centrifugation at 85,000x g for 2 hours at 4°C in a Sorvall WX 100 Ultra Ultracentrifuge (ThermoFisher). The supernatant was discarded and viral pellet resuspended in a volume of PBS containing calcium and magnesium (#14090-055 ...
-
bioRxiv - Neuroscience 2023Quote: ... p21) and pAAV target plasmid in a 4:1:1:2 molar ratio by use of Lipofectamine 2000 (ThermoFisher) according to company protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Samples were stored in 2% PFA at 4°C prior to analysis using an Attune NxT Flow Cytometer (Invitrogen) in the Flow Cytometry Core Facility of the Faculty of Medicine & Dentistry at the University of Alberta ...
-
bioRxiv - Microbiology 2023Quote: ... (BEI NR-52310) or pSARS2-SΔCT and 4 μg pTRMPSS2 (VRC/NIAID) diluted in 2 mL OPTIMEM media (Gibco) (DNA OPTIMEM mixture) ...
-
Entorhinal cortex vulnerability to human APP expression promotes hyperexcitability and tau pathologybioRxiv - Neuroscience 2024Quote: ... 2/3rd of the eluted protein samples were resolved on a 4–12% Bris-Tris gel (Invitrogen: cat# NW04125box) and subjected to Silverstein (Pierce™ Silver Stain Kit ...
-
bioRxiv - Bioengineering 2024Quote: ... PEGαMA hydrogels were made by dissolving the PEGαMA in pH 8.4 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Life Technologies) at 12.5-15.5 weight percent (wt%) ...
-
bioRxiv - Neuroscience 2024Quote: ... After 2-4 h the coverslips were flipped over an astroglia feeder layer in Neurobasal medium (GIBCO - Life Technologies) supplemented with SM1 supplement (1:50 dilution ...
-
bioRxiv - Neuroscience 2024Quote: ... After 2-4 h the coverslips were flipped over an astroglia feeder layer in Neurobasal medium (GIBCO - Life Technologies) supplemented with SM1 supplement (1:50 dilution ...
-
bioRxiv - Immunology 2024Quote: ... fluorescent antibodies (4 µg/mouse) and dyes (2 µl of a 10 mM Sytox Green solution; Thermo Fisher Scientific) were dissolved in 100 µl sterile PBS and injected intravenously 10 minutes before the surgery ...
-
bioRxiv - Molecular Biology 2024Quote: shRNA transfected cells were treated with 2 mM HU for 4 h along with 0.1 µg/mL colcemid (KaryoMAX, Gibco) 30 h post-transfection ...
-
DeFrND: detergent-free reconstitution into native nanodiscs with designer membrane scaffold peptidesbioRxiv - Biophysics 2024Quote: ... N,N’-Dimethyl-N-(Iodoacetyl)-N’-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)Ethylenediamine (IANBD amide) and Oregon GreenTM 488 (OG) maleimide were obtained from ThermoFisher. All other chemicals were acquired from Sigma.
-
bioRxiv - Cell Biology 2024Quote: ... then fixed with 4% formaldehyde in HBSS for 2 hrs and stained with Alexa Fluor 568 phalloidin (0.5 U/ml, Invitrogen) in PBS with 0.1% Triton X-100 (Sigma ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μL of AlamarBlue (Invitrogen) was added and plates were incubated in a Biotek HT plate reader at 37 °C for 4 h ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4% FBS (ThermoFisher; 10082147) in PBS ...
-
bioRxiv - Biophysics 2022Quote: ... 4 mM L-Glutamine (Gibco), in the presence of penicillin-streptomycin (Gibco ...
-
bioRxiv - Immunology 2022Quote: ... and Qubit 4 Fluorometer (Invitrogen).
-
bioRxiv - Cell Biology 2022Quote: ... in 4 ml OptiPro (Invitrogen). The mixture was incubated for 20 min at room temperature before being added to the cell cultures ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.1 fluo-4 (Molecular Probes), 0.1 Alexa Fluor 568 (for morphological visualization ...
-
bioRxiv - Bioengineering 2020Quote: ... 4 mM L-glutamine (Invitrogen), 100 units/mL penicillin (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... Fluo-4 AM (Invitrogen, USA). Any other reagents are produced in Ukraine.
-
bioRxiv - Microbiology 2021Quote: Superscript 4 Reverse Transcriptase (Invitrogen) was used according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Superscript 4 Reverse Transcriptase (Invitrogen) was used according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4% Knockout Serum Replacement (Gibco). Media exchanged for EVT differentiation media lacking NRG1 around day 7-10 of differentiation following the visible outgrowth of cells ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 mM EDTA (Thermo Fisher), 20% glycerol (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Fluo-4 (5μM) (ThermoFisher Scientific) was added to 500ul of cells in serum free media and incubated for 15 minutes at room temperature with protection from light ...
-
bioRxiv - Neuroscience 2021Quote: ... 4-chlorobenzenesulfonate salt (DiD, Invitrogen) in DMSO were mixed at the desired ratio and dried under a stream of nitrogen gas ...
-
Corticocortical Connections of the Rostral Forelimb Area in Rats: A Quantitative Tract-Tracing StudybioRxiv - Neuroscience 2020Quote: ... sucrose (4 g, Fisher Scientific), and DAB (50 mg ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Fluo-4 AM (Invitrogen, F14201), Pertussis toxin (PTX ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 4 mM of dNTPs (Invitrogen), 1% of Bovine Serum Albumine and sterile water ...
-
bioRxiv - Cell Biology 2021Quote: ... 4% PFA (Fisher Scientific, 04042) or 2% PFA ...
-
bioRxiv - Systems Biology 2021Quote: ... 4 mM L-glutamine (Invitrogen) and antibiotic-antimycotic (Invitrogen)) ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 mM GlutaMax™ (Gibco), 0.2 mM L-Cystine 2HCl ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 4 mM glutaMAX (Gibco), in a humidifying atmosphere with 5 % CO2 and 37 °C.
-
bioRxiv - Genomics 2022Quote: ... and Qubit 4 Fluorometer (Invitrogen™ ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4 mM L-glutamine (Gibco) and antimicrobial agents (100 units/ml Penicillin ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 4% FBS (Gibco), 1:100 Glutamax (Gibco) ...
-
bioRxiv - Immunology 2020Quote: ... then 4 μM TMRE (Invitrogen) was added at 37°C for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Fluo-4 (400 μM, Invitrogen) or Fluo-8 (300 µM ...