Labshake search
Citations for Thermo Fisher :
1551 - 1600 of 10000+ citations for Zika Virus NS1 Proteins Uganda Suriname Strains Duo Pack since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... virus was serially diluted in Vero maintenance media (MEM supplemented with 2% FBS and 1% each of GlutaMax (Gibco, Grand Island, NY), PenStrep ...
-
bioRxiv - Plant Biology 2023Quote: ... 1.0 μg DNase-treated RNA was reverse transcribed in a reaction volume of 20 μl containing oligo-(dT)19 primer and Moloney murine leukemia virus reverse transcriptase (Thermo Fisher Scientific). RT-qPCR analysis was then performed with 1.0 μl of 5-fold diluted cDNA using a SYBR premixed Ex Taq kit (Takara) ...
-
bioRxiv - Biophysics 2020Quote: ... mCherry-actin / GFP-myosin strain (Klingner et al., 2014)) were cultured in Dulbecco’s modified Eagle medium (D-MEM) 1g/l glucose (Invitrogen), supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... the MPS3-mCherry C-terminal fusion and the ADH1 terminator was amplified from genomic DNA of a strain harboring the MPS3-mCherry construct and blunt-cloned into the pJET2.1 vector (ThermoFisher). A BglII-BglII fragment from pSS266 containing MPS3-mCherry was then cloned into BamHI of pRS424 to generate pSS267 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mock) or reovirus strains T3SA+ or T3SA-at an MOI of 100 PFU/cell diluted in Opti-MEM (Gibco). Cells were incubated at room temperature (RT ...
-
bioRxiv - Biochemistry 2020Quote: ... The response regulators from Deinococcus radiodurans strain R1 (DrRR, gene DR_A0049) and Agrobacterium fabrum strain C58 (AtRR, gene Atu1989)22 were produced as a service (Invitrogen). The response regulator constructs were cloned into pET21b(+ ...
-
bioRxiv - Neuroscience 2021Quote: ... Constructs were validated by sequencing prior to site-specific recombination with the baculovirus genome provided by its host E.coli strain DH10Bac (Bac-to-Bac-System, Invitrogen). Positive recombinant clones were identified by blue-white screening and further confirmed by PCR ...
-
bioRxiv - Systems Biology 2021Quote: Yeast strains were stained with the red fluorescent dye FM4-64 (excitation/emission, 515/640 nm) (Thermo Fisher Scientific). Exponentially growing cells were incubated at an OD of 0.5-1 in YPD with 2 µM FM4-64 in the dark for 30 minutes at 30°C ...
-
bioRxiv - Microbiology 2021Quote: ... and the cap59Δ mutant (cap59) strains were incubated in YPD medium at 30°C and CO2-independent medium (Gibco) at 37°C until saturation ...
-
bioRxiv - Microbiology 2021Quote: ... pneumoniae strains were grown overnight at 37°C to stationary phase in LB-Lennox broth (Fisher Scientific, BP1427-2) with constant agitation ...
-
bioRxiv - Microbiology 2021Quote: ... and resuspended to OD 1.0 (1 × 109 bacteria/ml, validated by flow cytometry for all individual bacterial strains) in RPMI (Gibco) + 0.05% human serum albumin (HSA ...
-
bioRxiv - Microbiology 2021Quote: ... and H2B.V-over (Y strain) epimastigote forms were maintained in the abovementioned medium supplemented with 500 µg/mL G418 (Gibco) and 500 µg/mL puromycin and the last two lineages with blasticidin 10 μg/mL ...
-
bioRxiv - Microbiology 2020Quote: ... coli K-12 ΔhflX strain was complemented by reintroducing hflX ORF using pBAD replicative plasmid (Invitrogen, CAT No.: V44001) E ...
-
bioRxiv - Cell Biology 2021Quote: The laboratory strain of Leishmania donovani (Dd8) was routinely maintained in high glucose Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Life Technologies) supplemented with 10% of heat-inactivated foetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2022Quote: Prion-infected brain homogenate was prepared by homogenizing 30 brains from female C57Bl/6 mice terminally-infected with the ME7 prion strain in Dulbecco’s phosphate buffered saline lacking Ca2+ or Mg2+ ions (D-PBS; Gibco) to produce a pool of 130 ml 10% (w/v ...
-
bioRxiv - Cell Biology 2022Quote: All recombinant condensin complexes were expressed using insect cell strains from the Bac-to- Bac Baculovirus Expression System (ThermoFisher) as previously described (Kinoshita et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... annulata-transformed counterparts (TBL20, Hissar parasite strain)47 were cultured under the same conditions except that 2-mercaptoethanol (Gibco) was added to the culture medium ...
-
bioRxiv - Biophysics 2021Quote: ... Staphylococcus carnosus: Stock of target strain was incubated at 37°C overnight in anaerobic conditions (AnaeroGen 2.5L, Thermo Scientific) on to LB agar plate then resuspended in 0.9% NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... 10 g tryptone) from a single colony streaked from frozen strain stocks on an LB agar (1.5% w/v SelectAgar, Invitrogen) plate ...
-
bioRxiv - Systems Biology 2020Quote: ... Plasmid DNA from both the ETEC strains was additionally isolated using the Gene Jet Plasmid Miniprep Kit (Thermo Scientific) by following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... the synchronized ΔPfNot1.1 and the parental strain at 24 hpi was incubated in 20 μg/ml actD (Thermo Scientific) or DMSO for 4 hours ...
-
bioRxiv - Microbiology 2019Quote: ... The MamK-like gene from strain Poly30T was amplified by standard PCR procedures with Phusion DNA polymerase (Thermo Scientific) using the primers RPA821_NheI (CTAGCTAGCATGACCGACATC ACGACCGAC ...
-
bioRxiv - Microbiology 2021Quote: ... coli BW25113 cells and an appropriate mutant strain was used to inoculate 150 ml of Lennox LB (Fisher Scientific) and was cultivated to an OD578 of 0.5-0.6 at 37°C before harvesting by centrifugation (4500 × g ...
-
bioRxiv - Microbiology 2021Quote: ... The strains of bacteria were stained with a NucBlue Live ReadyProbes reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... baltica strain #1432 was extracted from 2 mL of overnight culture by Genomic DNA Purification Kit (Thermo Fisher Scientific) according to manufacturer’s protocol for Gram-negative bacteria ...
-
bioRxiv - Biochemistry 2021Quote: Prion-infected brain homogenate was prepared by homogenizing 200 brains from CD-1 mice terminally-infected with the RML prion strain in Dulbecco’s phosphate buffered saline (D-PBS; Gibco) to produce a pool of ~1 litre 10 % (w/v ...
-
bioRxiv - Microbiology 2020Quote: RNA extracted from the KS79 WT strain grown to E and PE phase was treated with DNase (ThermoFisher Scientific). 1 μg of DNase treated RNA was reverse transcribed with Protoscript II (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... cells persistently infected with BoDV-1 strain huP2br 20 were cultured in high-glucose (4.5%) Dulbecco’s modified Eagle’s medium (DMEM) (11965092; Thermo Fisher Scientific) supplemented with 5% fetal bovine serum ...
-
bioRxiv - Microbiology 2021Quote: ... an overnight culture of the parent strain was grown in Todd Hewitt (Beckinson Dickinson) broth with horse serum (Invitrogen), then diluted 200-fold and incubated at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... All strains were grown on Columbia agar supplemented with 7% (v/v) sheep blood (Oxoid™, Thermo Fisher Scientific) overnight at 37°C under aerobic conditions ...
-
bioRxiv - Microbiology 2022Quote: ... cruzi Sylvio X10 strain epimastigotes were grown in Liver Infusion Tryptose medium supplemented with 10% inactivated FBS (Life Technologies)22 at 27°C ...
-
bioRxiv - Microbiology 2022Quote: All parasite strains were derived from the reference strain NF54/3D7 and maintained in RPMI 1640 supplemented with 0.5% AlbuMAX II (Invitrogen) in an atmosphere of 5% O2 ...
-
bioRxiv - Physiology 2022Quote: ... 74)) were carried out by incubating macrophages with heat-killed FITC-labeled Escherichia coli strain K-12 bioparticles (ThermoFisher Scientific Vybrant phagocytosis assay kit ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA from 4 independent replicates for each strain/couple were quantified using the Qubit RNA HS Assay (Invitrogen) and confirmed on RNA6000 RNA chips on Bioanalyzer (Agilent ...
-
bioRxiv - Bioengineering 2023Quote: ... Yeast strains were propagated in YPD medium (10 g L-1 Bacto yeast extract (Thermo Fisher Scientific, Waltham MA), 20 g L-1 BactoTM peptone (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli strain BL21 Star™ (DE3) (genotype F-ompT hsdSB (rB-, mB-) gal dcm rne131 (DE3)) (Invitrogen, Waltham, MA) was used for the cell-extract for the cell-free protein synthesis reaction ...
-
bioRxiv - Microbiology 2023Quote: ... marcescens strain cultures were imaged on a glass slide at 20x using an EVOS M7000 microscope (Thermo Fisher Scientific). Confocal fluorescence microscopy timelapses of YenTc-sfGFP ...
-
bioRxiv - Microbiology 2023Quote: ... we transfected HEK293T cells grown in adherent culture with a vector encoding the structural polyprotein of SFV strain SFV4 (GenBank: AKC01668.1) using lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... injected with 1500 plaque-forming units (PFU) of JHMV (strain V34) suspended in 30 μL Hank’s balanced salt solution (ThermoFisher). Clinical disease was assessed for 21 days using a previously described scale69 ...
-
bioRxiv - Cell Biology 2024Quote: ... Plsamodium falciparum 3D7 strain was cultured under standard culture conditions in RPMI media supplemented with 0.5% (W/V) Albumax (Invitrogen). To generate the HA-glmS transgenic parasite lines ...
-
bioRxiv - Plant Biology 2024Quote: ... tricornutum strain UTEX 646 were PCR-amplified from cDNA using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Carlsbad, USA) and subcloned into the pGEM-T® Easy Vector (Promega ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The strain was cultivated in Thermo ScientificTM Biolite 25 cm2 cell culture flasks with vented lids (Thermo Fisher Scientific) in seawater cereal grass medium ...
-
bioRxiv - Cancer Biology 2019Quote: Proteins were isolated using RIPA buffer and protein concentrations were determined using the BCA Protein Assay Kit (Thermo Fisher Scientific). Total RNA was extracted using RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein concentrations were measured using a protein assay kit (Pierce™ BCA Protein Assay Kit, #23225, ThermoFisher Scientific, Cheshire, UK). Protein samples were resolved through 10% SDS-polyacrylamide gel and transferred to nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2021Quote: ... The supernatant containing proteins was collected and the protein concentration was determined by Pierce BCA Protein Assay Kit (Thermo Scientific). Immunoblotting analysis was carried out as previously described.(8 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Protein extracts were eluted in 2% SDS and protein concentration was measured using MicroBCA Protein Assay Kit (Thermo Fisher Scientific). Peptide isolations were digested by trypsin and SDS was removed employing Detergent Removal Spin Columns (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro sumoylation reactions were performed on protein array slides with more than 9000 human proteins spotted (ProtoArray® Human Protein Microarray v5.0, Invitrogen). The reaction was performed by the technical service of Invitrogen with our purified enzymes ...
-
bioRxiv - Molecular Biology 2020Quote: ... following which protein-protein complexes were purified with Pierce(tm) His Protein Interaction Pull-Down Kit (Thermo Fisher Scientific, #21277) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein concentrations were measured using the BCA Protein Assay Kit (Pierce™ BCA Protein Assay kit, Thermo Fisher Scientific, 23225) and a Tecan Infinite M200 Plate Reader.
-
bioRxiv - Biochemistry 2021Quote: ... Protein concentration was measured through the Bicinchoninic Acid protein assay (Pierce™ BCA Protein Assay Kit, Thermo Scientific™ 23225). Equal amounts of proteins extracts (20-30 μg for mitochondrial samples or 40 μg for total kidney homogenates ...