Labshake search
Citations for Thermo Fisher :
1551 - 1600 of 10000+ citations for Rat Golgi phosphoprotein 3 GOLPH3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 100 μL of TMB-ELISA substrate (1-Step; Thermo Fisher Scientific) was added into each well ...
-
bioRxiv - Immunology 2023Quote: ELISA plates were coated with 2 µg/ml NeutrAvidin (ThermoFisher, 31000) and blocked as described above ...
-
bioRxiv - Immunology 2023Quote: ... ELISA plates were developed using TMB solution (Life Technologies, Carlsbad, CA) and the reaction was stopped with 1 M HCl ...
-
bioRxiv - Bioengineering 2023Quote: ... the 1-step Ultra TMB-ELISA Substrate Solution (Thermo Scientific, USA) was added ...
-
bioRxiv - Immunology 2023Quote: ... 96-well high-binding ELISA plates (Nunc A/S, Roskilde, Denmark) were coated overnight at 4ºC with 100 μL of 0.45 μg/mL Spike protein ...
-
bioRxiv - Biophysics 2023Quote: ... The lysate is then collected for tPA assay by Elisa (Invitrogen). In another experiment ...
-
bioRxiv - Immunology 2023Quote: Nunc MaxiSorp 96 well ELISA plates (Thermo Fisher Scientific, Waltham, MA) were coated at 4°C overnight with filovirus GPs ...
-
bioRxiv - Bioengineering 2024Quote: ... Cell supernatants were collected and assayed using a TNFα ELISA (Invitrogen).
-
bioRxiv - Cell Biology 2024Quote: ... SASP factors: human IL-8 Uncoated ELISA (88-8086-88, Invitrogen), human IL-6 Uncoated ELISA (88-7066-88 ...
-
bioRxiv - Cell Biology 2024Quote: ... and human GRO alpha (CXCL1) Uncoated ELISA (88-52122-22, Invitrogen). Collagen type II synthesis ...
-
bioRxiv - Plant Biology 2021Quote: ... 21 nt GAPDH-dsRNA (provided in the kit) was labeled with Cy™ 3 utilizing the Silencer™ siRNA Labeling kit (ThermoFisher) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... Total RNA was extracted using Direct-zol RNA microprep kit and quantified using Qubit RNA High Sensitivity assay kit and Qubit 3 Fluorometer (Thermo Fisher Scientific). Purified RNA (50 ng ...
-
bioRxiv - Bioengineering 2019Quote: ... and stained with IL2-XE114-TNFmut (final concentration 10μg/mL) and detected with rat anti-IL2 (eBioscience 14-7029-85) followed by staining with anti-rat AlexaFluor488 (Invitrogen A21208). IL2-KSF-TNFmut (specific for an irrelevant antigen ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 rat anti-Rab1 and 3 rat anti-Rab11 (1:2000 concentrated supernatant) as primary antibodies and HRP-conjugated anti-rat IgG antibodies (1:20000, Life Technologies) as secondary antibodies ...
-
Impairment of a distinct cancer-associated fibroblast population limits tumour growth and metastasisbioRxiv - Cancer Biology 2020Quote: ... single cells were re-suspended at a density of 1-2 × 107 and subjected to magnetic sorting to exclude immune cells using rat-anti-mouse CD45 (R&D, MAB114) and CD24 (eBioscience, clone M1/69) magnetic sheep-anti-rat Ig Dynabeads (Invitrogen, #11035). FACS for FITC+/RFP-/DAPI-was used to obtain GFP+ve CAFs and to exclude RFP+ve tumour cells and dead cells ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were stained with unconjugated lineage rat antibodies (CD3, CD4, CD5, CD8, B220, Gr1, Mac1, and Ter119) followed by goat-α-rat PE-Cy5 (Invitrogen). Stem and progenitor cells were isolated using fluorescently labeled or biotinylated antibodies for the following antigens ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... M-100126-01-0005), rat Esrrg (Dharmacon, M-100212-01-0005), rat E2f1 (Dharmacon, M-102754-00-0005) or scramble control siRNA (ThermoFisher, 4390843), using the Viromer BLUE Transfection Reagent (Lipocalyx ...
-
bioRxiv - Neuroscience 2022Quote: ... The expression of Kir2.1EGFP was assessed with anti-GFP antibody (rat monoclonal Ab from Nacalai, Japan, GF090R; the secondary antibody, 488-anti Rat IgG from Invitrogen, A11006) (Mizuno et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... bakeri worm lysates or EVs were carried out with rat polyclonal anti-exWAGO antibody (raised against full length protein) or rat IgG (control) using protein L magnetic beads (Fisher Scientific). Equivalent amounts of the input ...
-
bioRxiv - Neuroscience 2024Quote: ... To visualize Gi-DREADD-mCherry expression in rCA2 of injected mice sections were stained with 1⁰ rat anti-mCherry (Life Technology #M11217) 1:500 + 2⁰ anti-rat 568 (Invitrogen #A11077) at 1:250 ...
-
bioRxiv - Neuroscience 2024Quote: ... In order to visualize AAV-retro positive cells sections were stained for mCherry (1⁰ rat anti-mCherry (Life Technology #M11217) 1:500 + 2⁰ anti-rat 568 (Invitrogen #A11077) at 1:250 ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Immunology 2022Quote: ... The supernatants of human CD19 CAR T cells or human TCR transfected CD8+ T cells were analyzed by IFNγ Human Uncoated Elisa Kit (Invitrogen, Thermo Fisher Scientific # 88-7316-88). Plates were read on BioRad plate reader at a wavelength 450 nm and subtracted by 595 nm.
-
bioRxiv - Microbiology 2020Quote: ... Supernatants were collected for analysis in an IL-12/IL-23 p40 (total) mouse uncoated ELISA kit (No. 88-7120-22; Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... CM was generated as mentioned above and GM-CSF was quantified using the mouse GM-CSF uncoated ELISA Kit (Thermo Fisher, cat.no. #88-7334-22) in accordance with the protocol provided by the manufacturer ...
-
bioRxiv - Immunology 2024Quote: The amounts of TNF-α and IL-6 in culture supernatants of LPS or Pam3cys-re-stimulated IS-trained macrophages were quantified using commercial human ELISA kits (Thermo Fisher Scientific, Waltham, MA, USA). Optical density was measured using the Infinite M200 (Tecan ...
-
bioRxiv - Cancer Biology 2019Quote: ... then attached spheroids were fixed and stained using the Protocol Hema 3 staining kit (Fisher Scientific).
-
bioRxiv - Cell Biology 2019Quote: ... Purification was completed using a 3 ml HisPur Ni-NTA Spin Purification Kit (Thermo Scientific, 88229) following the manufacturers recommendations ...
-
bioRxiv - Microbiology 2021Quote: ... The probes were labelled with biotin using Biotin 3’ End DNA Labeling Kit (Thermo scientific, USA). Hybridization signals were detected by Chemiluminescent Nucleic Acid Detection Module (Thermo scientific ...
-
bioRxiv - Microbiology 2021Quote: ... Library quantification was performed with a Qubit 3 Fluorometer with dsDNA Hs Assay kit (Life Technologies) and the quality of the libraries was assessed using a 2100 Bioanalyzer with High Sensitivity DNA kit (Agilent) ...
-
bioRxiv - Cancer Biology 2020Quote: The 3’ & 5’RACE products were cloned using TOPO TA Cloning Kit (Invitrogen, Cat #K4530-20), following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... and quantified on the Qubit 3 Fluorometer using Qubit™ 1X dsDNA HS Assay Kit (Invitrogen).
-
bioRxiv - Molecular Biology 2019Quote: ... Biotin 3’ end-labeled DNA oligomers were prepared using a biotin end-labeling kit (Thermo Scientific), and double-stranded DNA probes were generated by annealing sense and antisense oligomers ...
-
bioRxiv - Neuroscience 2019Quote: Dead and apoptotic cells were detected using CellEvent Caspase-3/7 Kit (#C10423, Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2021Quote: ... Total RNA (3 mg per sample) was treated with the TURBO DNA-free kit (Invitrogen AM1907) as previously described (10) ...
-
bioRxiv - Microbiology 2020Quote: ... A total of 3 micrograms (μg) of RNA was DNAse treated using the DNAfree kit (Ambion) as we previously described (16 ...
-
bioRxiv - Cell Biology 2020Quote: ... Caspase activity was assessed using CellEvent(tm) Caspase-3/7 Green Flow Cytometry Assay Kit (Invitrogen) following manufactures protocol ...
-
bioRxiv - Genetics 2022Quote: ... Amplification and biotin labeling of RNA was performed using GeneChip 3’ IVT express kit (Affymetrix, #901229). Affymetrix Drosophila Genome 2.0 array (# 900533 ...
-
bioRxiv - Microbiology 2023Quote: ... A total of 3 micrograms (µg) of RNA was DNAse treated using the DNAfree kit (Ambion) as we previously described (19-21) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... + hydrogen peroxidase 3% (1:100, Alexa Fluor 488 Tyramide SuperBoost Kit, goat anti-rabbit IgG, Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... Final library concentration was confirmed with Qubit 1X dsDNA HS Assay Kit and Qubit 3 (Invitrogen). Libraries were sequenced on a NextSeq 500 or NextSeq 2000 (Illumina).
-
bioRxiv - Immunology 2022Quote: ... They were both determined to be of the IgG2a subclass by using the Pro-DetectTM Rapid Antibody Isotyping Kit-Rat (Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2021Quote: ... and mACP-HA2 was visualized with the rat anti-HA 3F10 primary antibody and FITC-conjugated donkey anti-rat 2° antibody (Invitrogen Life Technologies A18746). Images were taken on an EVOS M5000 imaging system or Zeiss 880 laser-scanning confocal microscope fitted with an Airyscan detector ...
-
bioRxiv - Microbiology 2023Quote: ... and the endogenously C-terminal HA-tagged cytochromes were visualized with a Roche Rat anti-HA monoclonal 3F10 primary antibody and FITC-conjugated Donkey anti-Rat 2° antibody (Invitrogen Life Technologies A18746). Images were taken on DIC/brightfield ...
-
bioRxiv - Cell Biology 2023Quote: ... Alexa488 anti-rat and Cy3 anti-rat (1:250, Jackson) secondary antibodies or with Alexa647-conjugated Streptavidin (1:200, Thermo Fisher Scientific) and by counterstaining with DAPI (0.2 µg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... sera samples and conditioned tissue culture medium from rat hepatic stellate cells (HSCs) or primary rat hepatocytes (PCs) were stained with phycoerythrin (PE)-labeled Cell Mask (Thermo Fisher Scientific) or stained with Syto RNASelect (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... Lysates and immunecomplexes were separated by SDS-PAGE and blotted to detect either biotynlated proteins (IRDye® 680LT streptavidin (Li-Cor)) or CDPK3HA (rat-anti-HA)/anti-rat DyLight™ 800 (Invitrogen).
-
bioRxiv - Pathology 2023Quote: ... appropriate secondary antibodies were treated for 1-2 hours in the dark (AF555 anti-Rabbit, AF555 anti-Rat, AF647 anti-Rat (Invitrogen, Waltham, MA)) and washed in PBS containing 0.01% Triton X-100 ...
-
bioRxiv - Immunology 2023Quote: ... the appropriate secondary antibodies were added diluted in 1% BSA in PBS for 1 hour at a 1:1000 dilution (Goat anti Rat 488 Thermo Fisher Scientific a11006, Goat anti Rat 647 Thermo Fisher Scientific a21247 ...
-
bioRxiv - Genetics 2021Quote: ... The solid-phase sandwich ELISA (enzyme-linked immunosorbent assay) (Thermo Fisher, EH2IL2) was used to measure IL2 concentration from cell supernatant according to the manufacturer’s protocol(https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0014639_EH2IL2_ELISA_Kit_PI.pdf) ...