Labshake search
Citations for Thermo Fisher :
1551 - 1600 of 10000+ citations for BD 3 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Blood samples were collected (BD Microtainer Gold, ThermoFisher) at 11:00am during each session through retro-orbital bleeds ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were incubated with BD GolgiPlug (Fisher Scientific) or DMSO for 5 hours and collected at ∼60% confluency and run on an 8% SDS-polyacrylamide gel ...
-
bioRxiv - Microbiology 2024Quote: ... and M9 minimal media (BD Difco, Fisher Scientific) with 0.01% w/v decahydroquinoline (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... organoids were dissociated with dispase (#354235, BD Gibco) and TrypLE express (#12604013 ...
-
bioRxiv - Neuroscience 2023Quote: ... 10 μM ROCK inhibitor (Fisher Scientific BD, 562822), 0.2μM compound E (Calbiochem ...
-
bioRxiv - Bioengineering 2023Quote: ... CD47 was detected with B6H12 (BD and Invitrogen), TJC4 ...
-
bioRxiv - Bioengineering 2024Quote: ... brain heart infusion (BD Difco 237500, Fisher Scientific), mannitol salt agar (1054040500 ...
-
bioRxiv - Neuroscience 2021Quote: ... They were then rinsed in block for >30 min at room temperature before incubation in secondary antibody (1:250 Invitrogen #A21-42 AF488 anti-mouse IgM; 1:250 Life Technologies #A11029 AF488 anti-mouse IgG1; 1:250 Invitrogen #A21141 AF488 anti-mouse IgG2b) in blocking solution for > 1 hour at room temperature or overnight at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... and secondary antibody (anti-mouse IgG2a AF647, 1:2000, Invitrogen, A-21241; anti-mouse IgG AF568, 1:2000, Invitrogen, A-11031; anti-mouse Cy5, 1:1000), sequentially ...
-
bioRxiv - Biochemistry 2022Quote: ... Staining was performed at 4°C for four hours before being diluted 10X without washing and analyzed on a BD LSRII HTS flow cytometer with BD FACSDiva software or an Attune Flow Cytometer (ThermoFisher Scientific), or diluted 6X without washing and sorted by FACS on a FACS Aria contained in a biosafety cabinet ...
-
bioRxiv - Neuroscience 2019Quote: ... Alexa Fluor 488 anti-mouse IgG or Alexa Fluor 568 anti-mouse IgG (Thermo Fisher Scientific) at 1:500 for 2 h at 4°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... mouse macrophage RAW 264.7 cells and mouse myoblast C2C12 cells were cultured in DMEM medium (Gibco); colorectal carcinoma COLO 741 cells and B-CLL MEC1 cells were cultured in RPMI 1640 medium (Gibco) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Mouse cytokines were measured using a mouse cytokine 10-Plex Panel kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and anti-mouse Alexa A647 (1:1000; goat anti-mouse IgG Alexa Fluor 647; Invitrogen #A21236) for 2h at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse anti-CLIMP63 (followed by anti-Rabbit/Mouse/goat Alexa-dye coupled antibodies (1:400, Invitrogen). SiR-lysosome was used to visualize lysosomes in live microscopy (1:2000 ...
-
bioRxiv - Immunology 2020Quote: ... Goat anti-Mouse-(H&L)-Alexa488 and Goat anti-Mouse-(H&L)-Alexa647 secondary antibodies (Invitrogen), Alexa488-conjugated phalloidin (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: ... Cells were incubated in 1:1000 anti-mouse AlexaFluor488 or anti-mouse AlexaFluor594 (Thermo Fisher Scientific) and 4’,6-diamidino-2-phenylindole counterstain (DAPI ...
-
bioRxiv - Neuroscience 2023Quote: ... TMEM119 (mouse primary, Biolegend, 853302, 1:250, donkey anti-mouse 488 Life Technologies, A21202, 1:1000), and CX3CR1 (PE-rat ...
-
bioRxiv - Immunology 2022Quote: ... WT mouse CD8+ T cells were activated with anti-mouse CD3/CD28 dynabeads (11453D, Thermo Scientific) at a 1:1 cell-to-bead ratio ...
-
bioRxiv - Cancer Biology 2023Quote: ... and subsequently with fluorophore-labeled anti-mouse (goat anti-mouse Alexa Fluor 488; 1:2000; Invitrogen) and anti-rabbit secondary antibodies (goat anti-rabbit Alexa Fluor 594 ...
-
bioRxiv - Cell Biology 2023Quote: ... goat anti-mouse-IgG2 Alexa 568 and goat anti-mouse-IgG1 Alexa 488 (1:500, Invitrogen).
-
bioRxiv - Plant Biology 2024Quote: ... Mouse monoclonal antibodies were detected with goat anti-mouse IgG HRP-linked antibody (61-6520; Invitrogen) diluted 1:5000 (v/v) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The target oligonucleotide was 3’ end labeled with biotin using a Biotin 3’ End DNA labeling kit (Thermo Fisher Scientific, Waltham, MA, USA, #89818). The oligonucleotides used as probes or competitors in gel shift assays were end-labeled at their 3’ ends with biotin ...
-
bioRxiv - Genomics 2020Quote: ... Genomic PCR products obtained with primers 5’-CGCCATCAACTTCACCTAGC-3’ (forward) and 5’-TCTGGGAAGAAGTTTGGCCT-3’ (reverse) were sequenced using the BigDye® Terminator v1.1 Cycle Sequencing Kit (Thermo Fisher Scientific, Massachusetts, USA) on an ABI 3130xl Genetic Analyzer (Life Technologies ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame without the initiating ATG was amplified by PCR using primers 5’-CACCGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™6.2/N-EmGFP-DEST (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame with the initiating ATG was amplified by PCR using the primers 5’-CACCATGGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™-DEST40 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Cell Biology 2021Quote: ... a probe prepared by PCR on genomic mouse DNA with the primers 5’-CATATTCCAGGTCCTTCAGTGTGC-3’ and 5’-CACTTTAGGACGTGAAAT ATGGCG-3’ was labeled with Cy3 by random priming according to the kit instruction (Invitrogen Kit, Ref 18095–011).
-
bioRxiv - Neuroscience 2020Quote: Tissue sections from male (n = 3) and female (n = 3) rats were mounted on subbed glass slides (Fisher brand Superfrost Plus, Fisher Scientific, Hampton, NH, USA) and desiccated overnight (~16 h ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’) using Amplitaq gold 360 (Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using ABI BigDye v3.1 cycle sequencing reagents and analyzed on an ABI 3130XL Genetic Analyzer ...
-
bioRxiv - Cancer Biology 2021Quote: ... using a 10 min loading at 3 µL/min flow rate to a trap column (Acclaim™ PepMap™ 100, 2 cm × 75 µm, 3 µm, 100 Å - ThermoFisher Scientific). The separation was performed on an EASY-Spray™ C18 analytical column (25 cm × 75 µm ...
-
bioRxiv - Cancer Biology 2020Quote: ... Red cells were removed by incubating the splenocytes for 3 minutes with 3 ml eBioscience™ 1X RBC Lysis Buffer (Invitrogen, ThermoFisher, #00-4333-57). Cells were pelleted by centrifugation ...
-
bioRxiv - Bioengineering 2021Quote: ... sgRNA LA93527 was generated from a PCR DNA template (overlapping primers LA935 5’-GAAATTAATACGACTCACTATAGGACAGTGCGGTCCG-CAAGGGTTTTAGAGCTAGAAA-3’ and LA137 5’-AAAAGCACCGACTCGGTGCCA-CTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3’) containing the T7 promoter using the MEGAscript T7 Transcription kit (ThermoFisher Scientific, Walthum, MA USA). The reaction mix was incubated at 37°C for 16 hours and purified using the MEGAclear Transcription Clean-Up kit (ThermoFisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C (for P. miniata) or 20C (for P. regularis) in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Cancer Biology 2023Quote: To generate the pMIR-REPORT-SRSF3-3’UTR-S construct containing the 3’UTR of SRSF3 at the 3’ end of luciferase ORF in the pMIR-REPORT™ vector (Invitrogen, Waltham, MA, USA), fragments were amplified using specific primers and human genomic DNA as a template and cloned in a sense orientation using a standard laboratory method (S5 Table) ...
-
bioRxiv - Pathology 2023Quote: ... were incubated with 10 µM red fluorescent Lipophilic Tracer DiD (1,1’-dioctadecyl-3, 3, 39, 39-tetramethylindodicarbocyanine, 4-chlorobenzenesulfonate salt; Thermo Fisher Scientific, Waltham, MA, USA) and/or 2 mM SYTO RNA-Select Green Fluorescent Cell Stain Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Naïve hESCs were routinely passaged as single cells every 3 days at a ratio of 1:3 using TrypLE™ Express (1X) (Gibco, Thermo Fisher Scientific) and plated in fresh media supplemented with 10 μM of Y-27632 (Stemcell Technologies).
-
bioRxiv - Biochemistry 2023Quote: ... Cells were resuspended to a density of ∼2.5 × 105 cells and allowed to attach for 3 h in 3 ml Nunc cell culture tubes #156758 (Thermo Fisher Scientific, Waltham, MA, USA) before exchanging the medium into encystation medium ...
-
bioRxiv - Biophysics 2020Quote: ... and anti-mouse Alexa 594 (Invitrogen). Images were captured at room temperature with a Zeiss confocal system (LSM510 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse anti-CD3 (ThermoFisher; 1:200), Rabbit anti-IBA1 (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... Mouse anti-CD68 (ThermoFisher; 1:100), Rabbit anti-VIM (RayBiotech ...
-
bioRxiv - Cell Biology 2020Quote: ... donkey anti-mouse Alexa647 (Invitrogen; A31571), donkey anti-goat Alexa488 (Jackson Immunoresearch ...
-
bioRxiv - Cell Biology 2020Quote: ... α-Mouse IgG2b Alexa647 (ThermoFisher, 1:400), α-Mouse Alexa488 (Thermofischer ...
-
bioRxiv - Cell Biology 2020Quote: ... α-Mouse IgG1 Alexa488 (ThermoFisher, 1:500), α-Mouse IgG2b Alexa647 (ThermoFisher ...
-
bioRxiv - Cell Biology 2020Quote: ... goat anti-mouse-HRP (Invitrogen, 31430) (1:10,000) ...
-
bioRxiv - Microbiology 2021Quote: ... magnetic Dynabeads Pan Mouse IgG (Invitrogen) (1×108 beads / 0.25 ml ...
-
bioRxiv - Developmental Biology 2021Quote: ... mouse anti-GAPDH (1:1000, Invitrogen), and rabbit anti-GAPDH (1:1000 ...
-
bioRxiv - Microbiology 2021Quote: ... goat-anti-mouse IgG HRP (ThermoFisher), and rabbit-anti-rat IgG HRP (ThermoFisher) ...