Labshake search
Citations for Thermo Fisher :
1551 - 1600 of 10000+ citations for 6 FLUORO THIOCHROMAN 3 YLAMINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-caccatggttgtttcaatggctttgg-3’ and 5’-atttgagagagggtcgaaggag-3’ and cloned into pENTR/D-TOPO (Invitrogen). The final construct ...
-
bioRxiv - Plant Biology 2020Quote: ... obtained from the Arabidopsis Biological Resource Center (ABRC) using primers 5’-cacccactttctcttttgttagattctagttg-3’ and 5’-cattctataaat-tgattctcctcttctcc-3’ and cloned into pENTR/D-TOPO (Invitrogen). The construct was cloned into pGWB533 (Nakagawa et al. ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA was end labelled at the 3’ end with biotin using the Pierce RNA 3’ End Biotinylation Kit (Thermo Fisher). RNA quantity was assayed by running an RNA 6000 Nano chip on a 2100 Bioanalyzer ...
-
bioRxiv - Cancer Biology 2020Quote: mRNA associated with 1 to 3 ribosomes “Light polysomes” and mRNA associated with more than 3 ribosomes “Heavy polysomes” were extracted using TRIzol LS (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... EAC11-F: 5′-TTGAATTCGACTTCGACCGCGGCGTTTT-3′ and EAC12-R: 5′-TTGAATTCATGTCTTGGCCAGGGGAGAG-3 and cloned into the entry vector pCR8/GW/TOPO (Invitrogen). In the next step ...
-
bioRxiv - Molecular Biology 2019Quote: ... or for pre- and mature mRNAs (far-3, ZK970.7) or for pre-mRNA only (eft-3) and using StepOnePlus Real-time PCR Systems (Applied Biosystems) according to the suppliers’ protocols ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: To generate construct drg1 [prab-3∷GCaMP6m∷NLS∷unc-54 3’UTR] we performed a 4-way Gateway recombination reaction using LR Clonase II (Invitrogen). We recombined pDEST II with the following entry clones ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Cancer Biology 2021Quote: ... Lipophilic dye DiL (DilC18(3) (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate) at 1mM stock in ethanol (Invitrogen; Carlsbad, CA, USA) was used to label nanoparticles to observe in vitro delivery ...
-
bioRxiv - Immunology 2021Quote: ... Rps29 (forward 5’-GCAAATACGGGCTGAACATG-3’; reverse 5’-GTCCAACTTAATGAAGCCTATGTC-3’) by real-time PCR using TaqMan Gene Expression Assays (Applied Biosystems), Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Genetics 2020Quote: ... gins2 cDNA was cloned using primers gins2-F – 5’-CTCCTTGACGTCAGAGACACAT-3’ and gins2-R – 5’-GGAGAGGAATGGCTGAAGTACC-3’ into pCR-Blunt II-TOPO vector (Invitrogen) following the manufacturer’s protocol ...
-
Reducing mitochondrial ribosomal gene expression does not alter metabolic health or lifespan in micebioRxiv - Cell Biology 2022Quote: ... Genotyping proceeded according to the ICS protocol (Forward primer Ef 4877 5’-GACCCACATAAGCAGGGAAGGAGATG-3’, reverse primer L3r 4879 5’-CAATCTCCTGAGAATGTAGCCCACCAT-3’, Invitrogen). The Mrpl54 knock-out allele generated a 402 base-pair (bp ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... all used viruses were propagated to passage 3 on Calu-3 (ATCC HTB-55) cells in Advanced DMEM/F12 (Gibco), supplemented with HEPES ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Neuroscience 2023Quote: ... The carboxylic groups on the carbon fiber surface were electro-activated by incubation in 0.4 M 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC; Life Technologies) and 0.1 M and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Neuroscience 2023Quote: ... and loaded with the Fluorescent Dye-Based Rhod-3 AM following the manufactures’ instructions (Rhod-3 Calcium Imaging Kit, Cat.No. R10145; ThermoFisher scientific). Loading ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...
-
bioRxiv - Neuroscience 2023Quote: ... a 5040 amperometric cell and a Hypersil Gold C18 analytical column (3 μm, 100 × 3 mm; Thermo Fisher Scientific, USA). The mobile phase consisted of 0.1 M KH2PO4 buffer at pH 3.8 ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2023Quote: ... and primers (46) (5′-CAGAGATCGATCTGTTTCCTTGACACGCGTGCCACCATGTTCGTGTTCCTG-3′ and 5′-AATCTGTGTGCAGGGCGGCCGCTCAGGTGTAGTGCAGCTTCACG-3′) and cloned by using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Biochemistry 2023Quote: The panel of synthetic peptide standards and the products of immunoprecipitated heparan-sulfate 6-O-sulfotransferase 1/2/3 (H6ST-1/2/3) in vitro Tyr sulfation assays were analyzed using Proteome Discoverer 2.4 (Thermo Scientific) in conjunction with MASCOT 59 against either a custom database of all (12 ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
bioRxiv - Genomics 2023Quote: ... A single-cell suspension from PBMC from each patient was quantified and analyzed for viability using the Cell counter 3 (Countess 3, Invitrogen) and then loaded onto the 10X Genomics Chromium Single Cell Controller for isolation of single cells (10X Genomics) ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase 3/7 activity was assessed using the CellEvent Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Scientific, #C10427) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Bioengineering 2024Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (Cat. A638729) were purchased from Aladdin (Shanghai). KLH (Cat. 77600) was purchased from ThermoFisher. Peptide synthesis was conducted by Genscript (Nanjing ...
-
bioRxiv - Plant Biology 2019Quote: ... The mixture was analyzed by immunoblotting anti-6×His (Invitrogen, #MA1-135), anti-MBP (Santa Cruz Biotechnology ...
-
bioRxiv - Biophysics 2021Quote: ... Cell nucleus were stained with DAPI (4’,6-diamidino-2-phenylindole, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Molecular Biology 2020Quote: ... were subsequently labeled using 6-plex tandem mass tags (Thermo Fisher Scientific) following the manufacturer’s protocol but employing a reagent to peptide ratio of four ...
-
bioRxiv - Cancer Biology 2021Quote: ... qPCR was performed using FastSYBRGreen 5x MasterMix on a QuantStudio 6 (Invitrogen). Analysis was done using the ΔΔCt method using HPRT as housekeeping gene.
-
bioRxiv - Cell Biology 2020Quote: ... were seeded in 6-well plates in 1.5 ml DMEM (Life Technologies) supplemented with 10% (v/v ...
-
bioRxiv - Genetics 2021Quote: ... cells were grown in 2x YPD media (Fisher Scientific, DF0427-17-6) supplemented with 80 mg/L of adenine hemisulfate ...
-
bioRxiv - Neuroscience 2021Quote: ... in the Quant Studio 6 Flex system (Applied Biosystems, Thermo Fisher Scientific). Each sample was analyzed in duplicate ...
-
bioRxiv - Neuroscience 2021Quote: ... in the Quant Studio 6 Flex system (Applied Biosystems, Thermo Fisher Scientific). Each sample was analyzed in duplicate ...
-
bioRxiv - Molecular Biology 2021Quote: ... 20 µl reaction volume was loaded onto 6% DNA retardation gels (Invitrogen), and electrophoresis was carried out at room temperature in 0.5x Tris borate buffer ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... All preparations were stained with 4’,6’-diamidino-2-phenylindole (DAPI, Invitrogen) for 10 minutes to label nuclei and mounted with Fluoroshield medium (Sigma) ...
-
bioRxiv - Molecular Biology 2020Quote: ... on a QuantStudio™ 6 Flex Real-Time PCR System (Applied Biosystems). Transcript levels were analyzed using the delta delta Ct method and GAPDH was used as an internal control (110) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were resolved on a 6 % DNA Retardation gel (Thermo Fisher Scientific) with 0.5x TBE running buffer at 100 V for 60 min at 4 °C ...
-
bioRxiv - Bioengineering 2022Quote: ... Nuclei were counterstained with 4’,6’-diamidino-2-phenyliondole (DAPI; Invitrogen, D1306). Coverslips were mounted with ProLong™ Gold Antifade (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2022Quote: ... 30 min incubation with 4′,6-diamidino-2-phenylindole (DAPI, Life Technologies) (1:1000 ...