Labshake search
Citations for Thermo Fisher :
1551 - 1600 of 10000+ citations for 3RS 4 Dimethylamino 3 methyl 2 2 diphenylbutanenitrile Isodidiavalo since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were visualized with Hoechst (4′,6-diamidino-2-phenylindole) (DAPI) (Invitrogen; 3258, ICC/IHC 1:5,000).
-
bioRxiv - Physiology 2022Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole (1:2500, DAPI, ThermoFisher Scientific, Cat No. D1306). Images were taken using Zeiss 880 confocal microscopy and quantified by using Fiji/ImageJ86.
-
bioRxiv - Cancer Biology 2024Quote: ... The sections were mounted with 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher, Waltham, MA, United States) before imaging and we examined more than five different microscopic images (per section ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were stained with DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) NucBlue (Cat. #: R37606; Thermo Fisher Scientific). Slides were mounted using Aqua-Poly/Mount (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by 2 hour incubation at 4℃ with 50 µL of magnetic Dynabeads Protein G (Invitrogen, #10004D). Beads were washed with 1x TBS Tween-20 washing buffer (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... The broad-spectrum serine proteinase inhibitor 4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (AEBSF) was obtained from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were then incubated with rotation for 2 hours (at 4°C) with Talon cobalt resin (Thermofisher). After incubation ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were counterstained with 4’,6-diamino-2-phenylindole dihydrochloride (DAPI, 1:10000 in PBS, Thermo Scientific) and mounted with a cover glass using Fluoromount (Diagnostic BioSystems ...
-
bioRxiv - Plant Biology 2023Quote: ... 250 ng/ml 4′,6-diamidino-2′-phenylindole dihydrochloride (DAPI) or 500 nM SYTOX Orange (Life Technologies, Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... After another set of gentle washes and 4′,6-diamidino-2-phenylindole (DAPI) nuclear staining (Thermo Scientific, R37606 ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were visualized with 4′,6-diamidino-2-phenylindole (DAPI) in SlowFade Diamond antifade mounting medium (ThermoFisher). Primary antibodies were incubated with tissues overnight at 4°C in 1% normal donkey serum ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei staining was performed with 4’,6 diamidino-2-phenylindole dihydrochloride (DAPI, Molecular Probes, Eugene, OR, USA) at 300 nM in PBS ...
-
bioRxiv - Microbiology 2024Quote: ... GECs (8 x 104 cells) were seeded in 4-well chamber slides (Fisher Scientific# 12-565-2) and pre-treated with 2 mM Glu-Glu for 1 h prior to infection with wild-type or ΔgdhA strains of P ...
-
bioRxiv - Genomics 2024Quote: ... Sections were stained with DAPI (4 ',6' -diamidino-2-phenylindole) and mounted in Prolong Gold (Life Technologies). Imaging was performed on a Nikon Eclipse Ti Confocal at 20X objective and processed using Nikon Elements-AR ...
-
bioRxiv - Microbiology 2024Quote: ... hMDM nuclei were stained with 50 ng/ml 4’,6-diamidino-2- phenylindole (DAPI) (Invitrogen Cat. # D1306) for 7 min at room temperature ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclear counterstain was performed using 300 nM DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Thermo Fisher # D1306).
-
bioRxiv - Neuroscience 2024Quote: ... Nuclear counterstaining was performed using 300 nM DAPI (4’,6-Diamidino-2-Phenylindole, dihydrochloride) (Thermo Fisher # D1306).
-
bioRxiv - Neuroscience 2024Quote: ... Nuclei were stained for 5 minutes with 1 µM 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen), coverslips were mounted on glass slides with mounting medium (Dako) ...
-
bioRxiv - Biophysics 2024Quote: ... Samples were washed in PBS and stained with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Scientific, USA) for 5 minutes ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The cell nuclei was labelled by adding 4′,6-diamidino-2-phenylindole (DAPI, D1306, Thermo Fisher Scientific) for 15 min ...
-
bioRxiv - Biophysics 2024Quote: ... 4-(2-hydroxyethyl)-1-piparazineethanesulphonic acid (HEPES) and tris(hydroxymethyl)aminomethane (Tris) were purchased from Fisher Scientific.
-
bioRxiv - Bioengineering 2024Quote: ... Sections were counterstained with DAPI (4′,6-diamidino-2-phenylindole) and mounted with ClearMountTM mounting solution (Invitrogen).
-
bioRxiv - Cancer Biology 2024Quote: ... Gibco 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (1 M) was obtained from Invitrogen (Carlsbad, CA) and sterile filtered before use ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by staining with 4’,6-diamidino-2-phenylindole (DAPI) nuclear dye (Thermo Fisher Scientific, Cat# D3571) for 5 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... batches of 4 embryos were digested in 40µl of a solution of 2:1 0.25% Trypsin (Gibco): Accutase (StemCell Technologies ...
-
bioRxiv - Neuroscience 2021Quote: ... Cultured neurons were incubated with 3 μg/mL of the ratiometric calcium indicator Fura-2 AM (Life Technologies) in external recording solution for 30 min at 37°C and 5% CO2 ...
-
bioRxiv - Neuroscience 2020Quote: ... was aspirated and the fixed cells treated with 2-3 drops of ProLong Gold Antifade Mountant (Invitrogen #P36930) before imaging ...
-
bioRxiv - Plant Biology 2020Quote: ... seedlings were washed for 2-3 min in water and transferred to a chambered cover glass (Thermo Scientific), and imaged either as described above or using a Leica DM5500 wide field microscope (GFP filtercube ex ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was reverse-transcribed by addition of 3 μl of RT mix (2 μl 5x SSIV buffer [Invitrogen] ...
-
bioRxiv - Microbiology 2020Quote: ... Myoblat and myotubes viability was determined by 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT; Life Technologies) metabolization.
-
bioRxiv - Cancer Biology 2020Quote: ... then assayed in a standard MTT assay: 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (ThermoFisher, Waltham, MA) [39] ...
-
bioRxiv - Cancer Biology 2021Quote: ... After 3 and 7 days of treatment cells were stained with 2% crystal violet (CV) (40583100, Acros Organics, Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... equipped with an Acclaim Pepmap C18 trap column (2 cm * 75 µm, particle size: 3 µm; Thermo Fisher) and a C18 analytical column (50 cm * 75 µm ...
-
bioRxiv - Neuroscience 2022Quote: ... the cerebral cortexes from 2-3 P3-P5 C57BL/6 mice were collected in ice cold HBSS (Invitrogen), the tissue was washed three times with HBSS and digested with 0.04% trypsin (Sigma ...
-
bioRxiv - Genetics 2021Quote: ... Gels were run at 120V for 2-3 hours in Bolt MES SDS Running Buffer (Thermo Fisher Scientific) prior to protein transfer to Amersham Protran nitrocellulose blotting membrane (GE Healthcare ...
-
bioRxiv - Neuroscience 2021Quote: ... supplemented with NeuroCult™ SM1 neuronal supplement (STEMCELL), L-glutamine (2 mM, PAA) and 3% horse serum (Invitrogen) at 37°C in 5% CO2 ...
-
bioRxiv - Cancer Biology 2022Quote: Tail and ear fragments from C57/B6 or mT/mG mice were dissected and incubated in 2-3 hours at 37 °C in 950 µL of Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen), supplemented with 10% inactivated fetal bovine serum (FBSi ...
-
bioRxiv - Cell Biology 2020Quote: ... and induced to differentiate in myotubes for 2-3 days in differentiation media (DM: IMDM (Gibco, 21980-032) + 2% of horse serum (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 minutes prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Immunology 2020Quote: Cell viability was estimated by a quantitative colorimetric assay described for human granulocytes which were based on metabolic reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, Invitrogen) into coloured product formazan (Oez ...
-
bioRxiv - Microbiology 2023Quote: ... the cells were loaded with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific), according to the manufacturer’s instructions for kinetic assays and fluorescence in the live cells ...
-
bioRxiv - Pathology 2023Quote: Tail and ear fragments from mT/mG mice were dissected and incubated in 2-3 hours at 37 °C in 950 µL of Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen), supplemented with 10% inactivated fetal bovine serum (FBSi ...
-
bioRxiv - Genetics 2023Quote: ... 3-5 million cells or approximately 15 ug of DNA crosslinked with 2% PFA (Fisher Scientific F79-500) were used as input per reaction ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were treated with DMNB-caged cAMP (4,5-Dimethoxy-2-Nitrobenzyl Adenosine 3’,5’-Cyclicmonophosphate, Molecular Probes, D1037) for at least 30 min prior to imaging at a final concentration of 1 mM ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cancer Biology 2024Quote: ... or using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) reagent (Fisher Scientific, AC158992500, Waltham, MA, USA) at 570 nm ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mix 1 contains 3 siRNAs (CliniSciences, CRH7929) and Mix 2 contains two siRNAs (ThermoFisher Scientific, 1299001 and 4392420). As a negative control ...
-
bioRxiv - Plant Biology 2023Quote: ... 3 µg RNA from each sample was used to mix with 2×RNA loading dye (Thermo Fisher Scientific), denatured at 65℃ for 10 min ...
-
bioRxiv - Genomics 2024Quote: ... Fresh medium was added every 2-3 days and cells were passaged using 1X TrypLE Express (Life Technologies).
-
bioRxiv - Developmental Biology 2022Quote: ... They were then immobilized on glass slides using 2% agarose and injected with 1,1’-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate (DiI, Molecular Probes) or 3,3′-dioctadecyloxacarbocyanine perchlorate (DiO ...