Labshake search
Citations for Thermo Fisher :
1501 - 1550 of 10000+ citations for Zika Virus NS1 Protein Uganda strain since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... levels quantitative real-time PCR (RT-qPCR) was performed as previously described22 using TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher, #4444436) and an OneStepPlus Real-Time PCR System (96-well format ...
-
bioRxiv - Biochemistry 2020Quote: ... Total protein quantification of the glass bead protein extracts was conducted using the BCA Protein Assay kit (Thermo Fisher), and samples with equal amount of proteins were applied on SDS-PAGE gels ...
-
bioRxiv - Neuroscience 2020Quote: ... and pre-cleaned with protein A/G beads (Dynabeads™ Protein A, 10002D, Dynabeads™ Protein G, 10004D, Invitrogen). Immunoprecipitation was conducted with a mixture of Aβ antibodies (6E10 ...
-
bioRxiv - Cell Biology 2020Quote: IPs with FLAG-tagged protein were performed with Protein G magnetic beads (Invitrogen™ Dynabeads™ Protein G; #10004D) and α-FLAG antibody (Monoclonal ANTI-FLAG® M2 antibody produced in mouse ...
-
bioRxiv - Microbiology 2021Quote: Purified ThsA protein was freshly prepared and protein concentration was quantified using Qubit Protein Assay Kit (ThermoFisher cat # Q33212). Protein was diluted in wash buffer to a concentration of 147 ng/μl ...
-
bioRxiv - Microbiology 2021Quote: ... were used to pull-down FLAG-tagged proteins and any associated proteins rather than the Dynabead Protein G (Invitrogen) pre-bound with anti-FLAG M2 antibody (SigmaAldrich ...
-
bioRxiv - Neuroscience 2019Quote: Membrane proteins and cytosolic proteins were isolated using Mem-PER™ Plus membrane protein extraction kit (Thermo fisher scientific) according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2019Quote: ... and total protein concentration was quantified using a BCA protein assay (Pierce BCA Protein Assay kit, 23225, ThermoFisher Scientific). Samples were diluted to 0.8 ug/uL with a 1X cell lysis buffer provided by the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... Protein concentrations were measured using the Bio-Rad Protein Assay Kit or BCA Protein Assay Kit (Thermo Fisher Scientific). Equal amounts (25 μg or 10 μg ...
-
bioRxiv - Plant Biology 2024Quote: ... Protein concentration was quantified using the “Protein Quantification BCA Assay” kit (Pierce BCA Protein Assay Kit, Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2023Quote: ... The protein concentration of the protein extract was then measured with a BCA Protein Assay Kit (Thermo Fisher Scientific). A volume of each protein extract corresponding to 14 mg protein was transferred into a new 5-mL tube containing 150 µL streptavidin beads (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: Protein extracts from cells were assessed for protein concentrations using the Pierce BCA protein assay kit (Thermo Fisher Scientific). Equal amounts of protein lysates were added to SDS-PAGE gels and electrophoresis was performed ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein concentration in the protein extract was determined using a BCA protein assay kit (CAT# 23225, Thermo Fisher Scientific) and adjusted to 500 ng ...
-
bioRxiv - Biochemistry 2023Quote: ... Protein concentration in the protein extract was determined using a BCA protein assay kit (CAT# 23225, Thermo Fisher Scientific) and adjusted to 2 μg/μL with the IP lysis buffer ...
-
bioRxiv - Cell Biology 2023Quote: Protein concentrations were determined using the BCA protein assay (Micro BCATM protein assay kit; Thermo Fisher Scientific, MA, USA) and CLARIOstar microplate reader (BMG labtech Durham ...
-
bioRxiv - Biophysics 2020Quote: ... mCherry-actin / GFP-myosin strain (Klingner et al., 2014)) were cultured in Dulbecco’s modified Eagle medium (D-MEM) 1g/l glucose (Invitrogen), supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... the MPS3-mCherry C-terminal fusion and the ADH1 terminator was amplified from genomic DNA of a strain harboring the MPS3-mCherry construct and blunt-cloned into the pJET2.1 vector (ThermoFisher). A BglII-BglII fragment from pSS266 containing MPS3-mCherry was then cloned into BamHI of pRS424 to generate pSS267 ...
-
bioRxiv - Molecular Biology 2020Quote: ... mock) or reovirus strains T3SA+ or T3SA-at an MOI of 100 PFU/cell diluted in Opti-MEM (Gibco). Cells were incubated at room temperature (RT ...
-
bioRxiv - Biochemistry 2020Quote: ... The response regulators from Deinococcus radiodurans strain R1 (DrRR, gene DR_A0049) and Agrobacterium fabrum strain C58 (AtRR, gene Atu1989)22 were produced as a service (Invitrogen). The response regulator constructs were cloned into pET21b(+ ...
-
bioRxiv - Neuroscience 2021Quote: ... Constructs were validated by sequencing prior to site-specific recombination with the baculovirus genome provided by its host E.coli strain DH10Bac (Bac-to-Bac-System, Invitrogen). Positive recombinant clones were identified by blue-white screening and further confirmed by PCR ...
-
bioRxiv - Systems Biology 2021Quote: Yeast strains were stained with the red fluorescent dye FM4-64 (excitation/emission, 515/640 nm) (Thermo Fisher Scientific). Exponentially growing cells were incubated at an OD of 0.5-1 in YPD with 2 µM FM4-64 in the dark for 30 minutes at 30°C ...
-
bioRxiv - Microbiology 2021Quote: ... and the cap59Δ mutant (cap59) strains were incubated in YPD medium at 30°C and CO2-independent medium (Gibco) at 37°C until saturation ...
-
bioRxiv - Microbiology 2021Quote: ... pneumoniae strains were grown overnight at 37°C to stationary phase in LB-Lennox broth (Fisher Scientific, BP1427-2) with constant agitation ...
-
bioRxiv - Microbiology 2021Quote: ... and resuspended to OD 1.0 (1 × 109 bacteria/ml, validated by flow cytometry for all individual bacterial strains) in RPMI (Gibco) + 0.05% human serum albumin (HSA ...
-
bioRxiv - Microbiology 2021Quote: ... and H2B.V-over (Y strain) epimastigote forms were maintained in the abovementioned medium supplemented with 500 µg/mL G418 (Gibco) and 500 µg/mL puromycin and the last two lineages with blasticidin 10 μg/mL ...
-
bioRxiv - Microbiology 2020Quote: ... coli K-12 ΔhflX strain was complemented by reintroducing hflX ORF using pBAD replicative plasmid (Invitrogen, CAT No.: V44001) E ...
-
bioRxiv - Cell Biology 2021Quote: The laboratory strain of Leishmania donovani (Dd8) was routinely maintained in high glucose Dulbecco’s modified Eagle’s medium (DMEM; Gibco, Life Technologies) supplemented with 10% of heat-inactivated foetal bovine serum (FBS ...
-
bioRxiv - Biochemistry 2022Quote: Prion-infected brain homogenate was prepared by homogenizing 30 brains from female C57Bl/6 mice terminally-infected with the ME7 prion strain in Dulbecco’s phosphate buffered saline lacking Ca2+ or Mg2+ ions (D-PBS; Gibco) to produce a pool of 130 ml 10% (w/v ...
-
bioRxiv - Cell Biology 2022Quote: All recombinant condensin complexes were expressed using insect cell strains from the Bac-to- Bac Baculovirus Expression System (ThermoFisher) as previously described (Kinoshita et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... annulata-transformed counterparts (TBL20, Hissar parasite strain)47 were cultured under the same conditions except that 2-mercaptoethanol (Gibco) was added to the culture medium ...
-
bioRxiv - Biophysics 2021Quote: ... Staphylococcus carnosus: Stock of target strain was incubated at 37°C overnight in anaerobic conditions (AnaeroGen 2.5L, Thermo Scientific) on to LB agar plate then resuspended in 0.9% NaCl ...
-
bioRxiv - Microbiology 2022Quote: ... 10 g tryptone) from a single colony streaked from frozen strain stocks on an LB agar (1.5% w/v SelectAgar, Invitrogen) plate ...
-
bioRxiv - Systems Biology 2020Quote: ... Plasmid DNA from both the ETEC strains was additionally isolated using the Gene Jet Plasmid Miniprep Kit (Thermo Scientific) by following the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... the synchronized ΔPfNot1.1 and the parental strain at 24 hpi was incubated in 20 μg/ml actD (Thermo Scientific) or DMSO for 4 hours ...
-
bioRxiv - Microbiology 2019Quote: ... The MamK-like gene from strain Poly30T was amplified by standard PCR procedures with Phusion DNA polymerase (Thermo Scientific) using the primers RPA821_NheI (CTAGCTAGCATGACCGACATC ACGACCGAC ...
-
bioRxiv - Microbiology 2021Quote: ... coli BW25113 cells and an appropriate mutant strain was used to inoculate 150 ml of Lennox LB (Fisher Scientific) and was cultivated to an OD578 of 0.5-0.6 at 37°C before harvesting by centrifugation (4500 × g ...
-
bioRxiv - Microbiology 2021Quote: ... The strains of bacteria were stained with a NucBlue Live ReadyProbes reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA).
-
bioRxiv - Molecular Biology 2020Quote: ... baltica strain #1432 was extracted from 2 mL of overnight culture by Genomic DNA Purification Kit (Thermo Fisher Scientific) according to manufacturer’s protocol for Gram-negative bacteria ...
-
bioRxiv - Biochemistry 2021Quote: Prion-infected brain homogenate was prepared by homogenizing 200 brains from CD-1 mice terminally-infected with the RML prion strain in Dulbecco’s phosphate buffered saline (D-PBS; Gibco) to produce a pool of ~1 litre 10 % (w/v ...
-
bioRxiv - Microbiology 2020Quote: RNA extracted from the KS79 WT strain grown to E and PE phase was treated with DNase (ThermoFisher Scientific). 1 μg of DNase treated RNA was reverse transcribed with Protoscript II (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... cells persistently infected with BoDV-1 strain huP2br 20 were cultured in high-glucose (4.5%) Dulbecco’s modified Eagle’s medium (DMEM) (11965092; Thermo Fisher Scientific) supplemented with 5% fetal bovine serum ...
-
bioRxiv - Microbiology 2021Quote: ... an overnight culture of the parent strain was grown in Todd Hewitt (Beckinson Dickinson) broth with horse serum (Invitrogen), then diluted 200-fold and incubated at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... All strains were grown on Columbia agar supplemented with 7% (v/v) sheep blood (Oxoid™, Thermo Fisher Scientific) overnight at 37°C under aerobic conditions ...
-
bioRxiv - Microbiology 2022Quote: ... cruzi Sylvio X10 strain epimastigotes were grown in Liver Infusion Tryptose medium supplemented with 10% inactivated FBS (Life Technologies)22 at 27°C ...
-
bioRxiv - Microbiology 2022Quote: All parasite strains were derived from the reference strain NF54/3D7 and maintained in RPMI 1640 supplemented with 0.5% AlbuMAX II (Invitrogen) in an atmosphere of 5% O2 ...
-
bioRxiv - Physiology 2022Quote: ... 74)) were carried out by incubating macrophages with heat-killed FITC-labeled Escherichia coli strain K-12 bioparticles (ThermoFisher Scientific Vybrant phagocytosis assay kit ...
-
bioRxiv - Plant Biology 2024Quote: ... tricornutum strain UTEX 646 were PCR-amplified from cDNA using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, Carlsbad, USA) and subcloned into the pGEM-T® Easy Vector (Promega ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The strain was cultivated in Thermo ScientificTM Biolite 25 cm2 cell culture flasks with vented lids (Thermo Fisher Scientific) in seawater cereal grass medium ...
-
bioRxiv - Cell Biology 2024Quote: ... Plsamodium falciparum 3D7 strain was cultured under standard culture conditions in RPMI media supplemented with 0.5% (W/V) Albumax (Invitrogen). To generate the HA-glmS transgenic parasite lines ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA from 4 independent replicates for each strain/couple were quantified using the Qubit RNA HS Assay (Invitrogen) and confirmed on RNA6000 RNA chips on Bioanalyzer (Agilent ...