Labshake search
Citations for Thermo Fisher :
1501 - 1550 of 7395 citations for Recombinant Human NEK7 His & GST tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: A recombinant Streptococcus pyogenes Cas9 (GeneArtTM Platinum Cas9 Nuclease, Thermo Fisher Scientific) together with a single-guided RNA (GTAAAGCAGGGCTACATGAG ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 µg/ml mouse recombinant epidermal growth factor (EGF; Thermo Fisher Scientific), 10nM [Leu15]-gastrin I (Merck) ...
-
bioRxiv - Bioengineering 2022Quote: ... putida recombinants was quantified using Trace 1310 Gas Chromatograph (Thermo Fisher Scientific) equipped with ZB-WAX plus column (30 m ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant baculoviruses were prepared in Spodoptera frugiperda (Sf9) cells using Cellfectin (Invitrogen) following the Bac-to-Bac protocol (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: ... recombinant baculoviruses were produced using the ViraPower BacMam Expression System (Thermo Fisher). In brief ...
-
bioRxiv - Immunology 2022Quote: ... The supernatant containing recombinant antibody was incubated with protein A resin (ThermoFisher) overnight at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 U Uracil N-glycosylase and 0.5 U recombinant Taq polymerase (Invitrogen). Quantitative real-time PCR was run with initial incubation at 25°C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant baculovirus expressing A2AR was prepared using Bac-to-Bac system (Invitrogen). Spodoptera frugiperda 9 (Sf9 ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant H2 was expressed in Invitrogen™ 293FT cells (Thermo Fisher Scientific). 293FT cells were cultured in Gibco™ DMEM (high glucose ...
-
bioRxiv - Immunology 2023Quote: Recombinant antibodies were generated using the Expi293 or Expi293 FUT8−/- system (ThermoFisher) using previously described protocols (60) ...
-
bioRxiv - Neuroscience 2023Quote: ... while for the short we used the Taq DNA Polymerase Recombinant (Invitrogen) kit ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Recombinant protein was extracted using BugBuster Protein Extraction Reagent (Thermo Scientific, USA) and purified using cOmplete His-Tag Purification Resin (Roche ...
-
bioRxiv - Biophysics 2023Quote: Recombinant tubulin was purified by using Bac-to-Bac system (Life Technologies) as described previously18 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cholera Toxin Subunit B (Recombinant) Alexa Fluor 488TM Conjugate (C34775, Invitrogen, Belgium), Tetramethylrhodamine ...
-
bioRxiv - Biophysics 2023Quote: ... recombinant baculoviruses were prepared using the Bac-to-Bac expression system (Invitrogen). The proteins were expressed in Trichoplusia ni (BTI-Tn5B1–4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the addition of RNaseOUT recombinant ribonuclease inhibitor (ThermoFisher Scientific 10777-019) as per manufacturer’s instructions ...
-
bioRxiv - Biophysics 2024Quote: ... Recombinant CtNAT10 protein was expressed in both Sf9 cells (ThermoFisher, cat #12659017) and homemade bGroESL cells (See Experimental Model and Subject Details) ...
-
bioRxiv - Synthetic Biology 2023Quote: All recombinant proteins were produced in Escherichia coli BL21(DE3) pLysS (Invitrogen) transformed with respective plasmids ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL of RNaseOUT™ Recombinant RNase Inhibitor (40 units/μL, Invitrogen) and 2 μL of SuperScript™ III RT (200 units/μL ...
-
bioRxiv - Plant Biology 2020Quote: ... and 1 μL purified GST-FDL1 protein were incubated at room temperature for 20 min and loaded on a 6% DNA retardation gel (Life Technologies) before transfer to a nylon membrane ...
-
bioRxiv - Molecular Biology 2020Quote: GST or GST-PHF1-tudor proteins (10 μg each) were incubated with 4 μl (25% slurry) of Glutathione Magnetic Beads (88821; Thermo Scientific) in 250 μl of binding buffer (125 mM Tris-HCl pH8.0 ...
-
bioRxiv - Cell Biology 2020Quote: ... the pooled anion exchange fractions were phosphorylated in vitro overnight at 4 °C with 1 mM ATP and 1 μg of PKR(252-551)-GST enzyme (Thermo Scientific) per mg of eIF2α ...
-
bioRxiv - Microbiology 2020Quote: ... followed by incubation for 3 hr at 4°C with 250 μg of GST-fusion protein coupled to glutathione-agarose (Thermo Scientific). Beads were then washed four times (pull down buffer containing 0.1% Triton X-100 ...
-
bioRxiv - Immunology 2019Quote: ... Lysates and purified products were analyzed by acrylamide gel electrophoresis followed by standard coomassie blue staining and western blot analysis using a rabbit anti-GST Tag polyclonal antibody (CAB4169, Thermo Fisher).
-
bioRxiv - Microbiology 2020Quote: ... Two and a half micro liter of pBAD-C+SPA+gst sample as well as 5 μL of Spectra Multicolor Low Range Protein Ladder (Thermo Scientific) and 10 μl of samples or controls were loaded on tricine-SDS-gels (Schägger ...
-
bioRxiv - Neuroscience 2019Quote: Full-length Eya1 wild type and mutant D328A protein in a GST-fusion format were generated using the Bac-to-Bac Baculovirus Expression system (ThermoFisher Scientific) and expressed in Sf9 insect cells ...
-
bioRxiv - Biochemistry 2020Quote: ... ELISA wells were washed four times with PBS-T and incubated with 50 μL/well of anti-GST (Invitrogen MA4-004) or anti-MAR (Millipore-Sigma MAB1076 ...
-
bioRxiv - Pathology 2023Quote: The in vitro pull-down assay to assess the protein-protein interaction between YcgR and SpeA was conducted as previous described by using the Pierce GST Protein Interaction Pull-Down Kit (Thermo Fisher)(68) ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 µg of the proteins was incubated with equivalent amount of GST-α synuclein fusion protein at 4°C overnight in the present of Ni-NTA beads (Invitrogen). The pull-downs were washed 4 times with lysis buffer and boiled in 2X Laemmli sample buffer for five minutes.
-
bioRxiv - Biochemistry 2023Quote: ... Interaction of His-fused proteins with other purified proteins (e.g. GST-PKAC) or synthetic peptides was studied by pulldown using Ni-NTA affinity resin (HisPur, Thermo scientific # 88221). GST-fused proteins were pulled down on glutathione-Sepharose beads (Amersham Biosciences) ...
-
bioRxiv - Biochemistry 2023Quote: ... HP1 proteins was released from the GST-tag by overnight thrombin digestion followed by purification on a 50HQ 10×100 column (Applied Biosystems) in a continuous gradient of 50 –1000 mM NaCl ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Genomics 2020Quote: For Hi-C experiments knockdown of CLAMP was validated using the Western Breeze kit (Invitrogen). Antibodies used for detection were a previously described custom rabbit antiCLAMP (1:1,000 ...
-
bioRxiv - Genomics 2020Quote: The psep-1::his-58::eGFP transgene was generated using three-site Gateway cloning (Invitrogen) in the MosSCI compatible vector pCFJ150 ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 10 % heat-inactivated fetal bovine serum (HI FBS, Thermo Fisher Scientific, Loughborough, UK) and antibiotics (100 U/mL penicillin and 100 µg/mL streptomycin ...
-
bioRxiv - Microbiology 2019Quote: ... A 1:150 dilution of anti-His antibody labelled with AF647 (Thermo Fisher, Waltham, MA) was then added to cells ...
-
bioRxiv - Cell Biology 2019Quote: ... The His-mCherry-fusion proteins were purified using a Ni-NTA column (Thermo Fisher Scientific). The eluted proteins were dialyzed in 1 L dialyzed buffer (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Microbiology 2019Quote: ... mouse anti-6x-His epitope tag monoclonal antibody (Thermo Fisher Scientific, Cat. No. MA1-21315); LI-COR IRDye 800CW goat anti-rabbit IgG (LI-COR ...
-
bioRxiv - Molecular Biology 2019Quote: ... The Jpx E1-E3 isoform was cloned into pEF1/V5-His vector (Invitrogen Cat# V92020), which contains an EF-1α promoter for mammalian expression and a T7 promoter for in vitro transcription ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Im7-6 was purified from IVG reactions using magnetic His-tag Dynabeads (Thermo Fisher Scientific). The IVG reactions were diluted in 90 µl of Buffer 1 (50 mM NaH2PO4 and 300 mM NaCl ...
-
Genomic approach for conservation and the sustainable management of endangered species of the AmazonbioRxiv - Genomics 2020Quote: ... One microliter of amplification was mixed with 8.5 μL Hi-Di deionized formamide (Applied Biosystems), and 0.5 μL GeneScan 500 LIZ (Applied Biosystems ...
-
bioRxiv - Biochemistry 2021Quote: ... Cleaved 14His-SUMO and His-Ulp1 were removed by affinity to Ni-NTA Agarose (Invitrogen). The flowthrough was diluted 1:5 with MonoQ buffer A and loaded onto a MonoQ 5/50 GL column (GE Healthcare) ...
-
bioRxiv - Microbiology 2020Quote: ... under the control of an inducible pBAD promoter (pBAD/His A, Thermofisher, Catalog number 43001) (Supplementary Table 5) ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR products were subcloned into the pAc5.1/V5-His A vector (Invitrogen, V4110-20) with a GFP tag sequence at its 3’ end terminus ...
-
bioRxiv - Microbiology 2019Quote: ... with 30% L929 supernatant and 20% fetal bovine serum (HI-FBS, Thermo Scientific, Waltham, MA) for 48 hours at 37°C under 5% CO2 ...
-
bioRxiv - Biochemistry 2022Quote: His-V5-uL4-CGN mRNAs were obtained using a mMESSAGE mMACHINE T7 kit (Invitrogen #AM1344) using linear DNA templates ...
-
bioRxiv - Molecular Biology 2020Quote: ... the reaction pellets were dried and resuspended in Hi-Di formamide (Applied Biosystems/Life Technologies).
-
bioRxiv - Molecular Biology 2020Quote: ... the reaction pellets were dried and resuspended in Hi-Di formamide (Applied Biosystems/Life Technologies).
-
bioRxiv - Microbiology 2021Quote: ... The his-tag was cleaved using AcTEV protease according to manufacturer’s instructions (Invitrogen, Carlsbad, CA), and the his-tagged protease and noncleaved uSpike protein were removed by binding to Ni-NTA resin ...