Labshake search
Citations for Thermo Fisher :
1501 - 1550 of 5122 citations for Cytomegalovirus Purified Antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
A new vulnerability to BET inhibition due to enhanced autophagy in BRCA2 deficient pancreatic cancerbioRxiv - Cancer Biology 2023Quote: ... The collected RNA was purified with PureLink RNA Mini Kit (Invitrogen, 12183018A) following the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... Purified libraries were quantified with a High Sensitivity dsDNA kit (Thermo Fisher) on Bioanalyzer 2100 (Agilent #G2939BA) ...
-
bioRxiv - Biophysics 2023Quote: Myosin-5 was purified from transiently transfected FreeStyle HEK293 cells (Thermo Fisher) as previously described (32) ...
-
bioRxiv - Cell Biology 2023Quote: ... Biotinylated proteins were purified using 10 µl streptavidin-coupled magnetic beads (ThermoFisher) and eluted in 40 µl 1x Lämmli buffer at 70°C for 10min ...
-
bioRxiv - Biochemistry 2023Quote: ... Plasmids were purified using the GeneJET plasmid miniprep kit (Thermo Fisher Scientific) and insertion and mutagenesis were verified by Sanger sequencing.
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were purified using PureLink PCR Purification Kit (Thermo Fisher Scientific). The final PCR products were submitted for next generation sequencing using NovaSeq SP PE250 (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... Thereafter the samples were purified by Pierce C18 Spin Columns (Thermo Scientific) and dried ...
-
bioRxiv - Plant Biology 2023Quote: ... The proteins were then affinity purified with Ni2+ columns (Invitrogen, R901-01), and the eluted proteins were further purified via gel filtration chromatography with a superdex 200 (GE Healthcare ...
-
bioRxiv - Plant Biology 2023Quote: ... coli strain BL21 and purified using PierceTM glutathione magnetic agarose (ThermoFisher Scientific). The purified protein was digested with PreScission Protease (APEXBIO ...
-
bioRxiv - Molecular Biology 2023Quote: ... Purified DNA was eluted in 50 µl of nuclease-free H2O (Ambion). A second cleanup of the libraries was performed using 1 volume of AMPure XB beads (Beckman) ...
-
bioRxiv - Plant Biology 2023Quote: ... Peptides purified by C18 tips according to the manufacturer’s protocol (Pierce/ThermoFisher). Purified peptides were then lyophilized and resuspended in 100 mM HEPES-KOH ...
-
bioRxiv - Systems Biology 2023Quote: ... Purified amplicons were quantified by Qubit™ dsDNA Quantification Assay Kits (ThermoFisher) and sequenced on a HiSeq2500 with a Rapid Run (200 cycle ...
-
bioRxiv - Systems Biology 2023Quote: ... Purified amplicons were quantified by Qubit™ dsDNA Quantification Assay Kits (ThermoFisher) and validated by D1000 ScreenTape Assay for TapeStation Systems (Agilent ...
-
bioRxiv - Genetics 2023Quote: ... The synthesized dsRNA was purified using MEGAclear Transcription Cleanup kit (Thermo Fisher), the resulting RNA pellets were resuspended with nuclease-free water ...
-
bioRxiv - Physiology 2023Quote: ... Samples were then purified using the GeneJET PCR Purification Kit (Thermo Scientific) and visualized on agar gels to confirm results ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Purified PCR products were quantified using the Quant-iT dsDNA kit (Invitrogen) and 60ng from each of the 15 different UPTAG libraries and ...
-
bioRxiv - Immunology 2023Quote: ... Reverse: ACATCTAAGGGCATCACAGACC) and purified by gel extraction (Quick Gel Extraction kit, Invitrogen). qPCR was performed on a QuantStudio 7 flex and expression calculated using standard curves and results normalised to 18s expression ...
-
bioRxiv - Genetics 2023Quote: ... Samples were further purified by 2% E-Gel SizeSelect agarose gel (Invitrogen). The resulting products were purified using QIAquick PCR Purification Kit (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... plated out and purified with the GeneJET Plasmid Miniprep Kit (Thermo Fisher). To validate the correct inserts ...
-
bioRxiv - Biochemistry 2023Quote: ... KKO was then purified using Protein A Sepharose beads (Thermo Fisher Scientific) packed in an Econo-chromatography column (BioRad ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was then amplified and purified before quantification with Qubit 4 (Invitrogen) and quality assessment with TapeStation 4150 (Agilent) ...
-
Immunogenic fusion proteins induce neutralizing SARS-CoV-2 antibodies in the serum and milk of sheepbioRxiv - Bioengineering 2022Quote: ... Transfection-ready plasmids were purified from bacterial cultures by maxiprep (Invitrogen, #K20006). Expi293 HEK cells (Thermofisher ...
-
bioRxiv - Bioengineering 2023Quote: ... Total RNA was purified using a Nanodrop spectrophotometer (ND1000, ThermoFisher, MA, USA), and cDNA was synthesized using iScript™ cDNA Synthesis Kit (#1706691 ...
-
bioRxiv - Biochemistry 2022Quote: ... RNA was then purified using the MEGAClear Transcription Clean-Up Kit (ThermoFisher) per manufacturer protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... PCR products were purified using the PureLink Quick Gel Extraction Kit (Invitrogen) and ligated into the pENTR vector for final cloning into the pSLIK-Neo destination vector (Addgene 25735)23 using LR Clonase gateway reaction vector (Invitrogen) ...
-
bioRxiv - Biophysics 2023Quote: ... The PCR product was purified by GeneJET PCR purification kit (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2023Quote: ... Peptides were purified and concentrated by C18 spin columns (Thermo Fisher Scientific). Purified samples were vacuum-dried and reconstituted in 0.1% (v/v ...
-
bioRxiv - Biophysics 2023Quote: ... Purified arrestin was first incubated with 0.8 equivalents of AlexaFluor350 maleimide (ThermoFisher) for 3 hours in the dark ...
-
bioRxiv - Genomics 2022Quote: ... Ligated DNA was affinity-purified with Dynabeads MyOne Streptavidin C1 beads (Invitrogen) as described (Liu et al ...
-
bioRxiv - Developmental Biology 2023Quote: ... Then the sgRNAs were purified using the MEGAclear kit (ThermoFisher, Cat# AM1908) with ammonium acetate ethanol precipitation.
-
bioRxiv - Bioengineering 2023Quote: Total RNA was purified from cultured cells using Trizol Reagent (Life Technologies) per manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... and the Wuhan spike protein was purified using Talon Resin (Thermo Scientific) while the D614G VFLIP spike was purified on a StrepTrap XT column (GE Healthcare) ...
-
bioRxiv - Genetics 2023Quote: ... Some PCR reactions were purified using the PCR purification kit (Fisher Scientific) and sequenced to confirm the insertion point (Eurofins).
-
bioRxiv - Genomics 2022Quote: ... The CellTag amplicons are purified using streptavidin-coated magnetic bead pulldown (ThermoFisher Scientific ...
-
bioRxiv - Plant Biology 2023Quote: ... The obtained RNA was then purified using GeneJET kit (Thermo Fisher Scientific). The concentration and purity of the RNA were measured using Nanodrop 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Systems Biology 2023Quote: ... We quantified purified libraries using Qubit dsDNA High Sensitivity Assay (Invitrogen, Q32854) and the Agilent Bioanalyzer High Sensitivity DNA Kit (Agilent ...
-
bioRxiv - Systems Biology 2023Quote: ... We quantified purified libraries using Qubit dsDNA High Sensitivity Assay (Invitrogen, Q32854) and the Agilent Bioanalyzer High Sensitivity DNA Kit (Agilent ...
-
bioRxiv - Plant Biology 2023Quote: ... and poly(A)-RNA was purified using Dynabeads mRNA Purification Kit (Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... we purified the amplicons and performed TA cloning using a kit (Invitrogen). Plasmids from 8-10 colonies from a single TA cloning reaction were cultured for miniprep and submitted for Sanger sequencing to confirm their genotype prior to further experimentation.
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was purified from samples using the RNAqueous Micro kit (Ambion) and its DNAse treatment ...
-
bioRxiv - Biophysics 2023Quote: Recombinant tubulin was purified by using Bac-to-Bac system (Life Technologies) as described previously18 ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was purified with the TRIzol™lJ reagent (#15596018, Invitrogen) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... amplicons were purified and normalized with the SequalPrep Normalization Plate Kit (Invitrogen) following the manufacturers’ instructions ...
-
bioRxiv - Genomics 2023Quote: ... The amplicons were purified with The GeneJET PCR Purification Kit (ThermoFisher Scientific) and were subjected to Sanger sequencing (Macrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... and RNA was purified with PicoPure RNA Isolation Kit (Thermo Fisher Scientific). We determined RNA concentration with 2100 Bio-analyzer (Agilent Technologies) ...
-
bioRxiv - Genomics 2023Quote: ... We quantified the purified RNA with a NanoDrop One spectrophotometer (ThermoFisher Scientific). Subsequently ...
-
bioRxiv - Neuroscience 2023Quote: ... and Biotinylated Affinity Purified Goat Anti-Rabbit IgG secondary antibody (ThermoFisher, 32054) for a subset of tissue samples ...
-
bioRxiv - Plant Biology 2023Quote: ... This ligated cDNA was purified again using MyONE Silane beads (ThermoFisher Scientific). Quantification of the cDNA samples was done via qPCR ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The plasmid was purified using the GeneJET Plasmid Miniprep Kit (Thermo Scientific) and assembly junctions were verified by Sanger sequencing ...
-
bioRxiv - Plant Biology 2023Quote: ... PCR products were purified using Quick PCR Purification Kit (Invitrogen, Carlsbad, CA) and sequenced by EurofinGenomics (Louisville ...