Labshake search
Citations for Thermo Fisher :
1501 - 1550 of 3080 citations for ANKZF1 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... or a non-targeting siRNA pool (Pool #1, D-001206-13, ThermoFisher Scientific). Efficiency of mRNA depletion was assessed 72 hours post-transfection using qPCR or western blot in the case of ACSL1 (Proteintech ...
-
bioRxiv - Biochemistry 2019Quote: ... or SREBP1-specific siRNA (sequence information available at the manufacturer, Thermo Fisher Scientific). The cells were transfected overnight using the Lipofectamine RNAi Max transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... All plasmids and siRNAs were transfected into different cells using lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... siRNA transfection was done with Lipofectamine 2000 Transfection Reagent (Thermo Fisher Scientific, USA) in Opti-MEM Reduced Serum Media (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... siRNAs were reverse-transfected with 5×103 HT1080-ACE2 using RNAiMAX (Thermo Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: Small interfering RNAs (siRNA) were transfected into subconfluent cells using Lipofectamine RNAiMax (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... siRNAs were applied in a concentration of 25 nM in OptiMEM medium (Gibco). APC were transfected analogously in the second week in culture ...
-
bioRxiv - Cell Biology 2021Quote: ... 60µL of 1µM siRNAs were added to 180µL Opti-MEM (Gibco, cat# 31985070) for the final concentration of 50nM and then mixed with diluted Dharmafect-1 in Opti-MEM (1.2µL Dharmafect-1 in 238.8µL Opti-MEM) ...
-
bioRxiv - Cell Biology 2021Quote: ... All siRNA transfections (40 nM, 72 h) were performed using Lipofectamine RNAiMAX (Invitrogen) as per manufacturer’s instruction.
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblasts were transfected with siRNA using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and stealth RNAi siRNAs specific for hnRNPK (MSS205172 and MSS205173, Thermo Fisher Scientific). The siRNA sequences are listed in Supplemental Table 1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... DDR2#2 (HSS107352) and FAK (PTK2) siRNA duplexes were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2019Quote: ... Transfection of siRNA was carried out using Lipofectamine RNAi MAX (Thermo Fisher Scientific), at a final concentration of 50 nM ...
-
bioRxiv - Cell Biology 2021Quote: ... p97 siRNAs (2-HSS111263 and 3-HSS111264) were from Invitrogen (Thermo Fisher Scientific). p97 rescue constructs were previously published 53 and were resistant to siRNA # 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... The transfections of siRNA were performed using Oligofectamine reagent (Thermo Fisher Scientific; 12.252.011) according to the manufacturer’s protocol and were repeated at days 1 ...
-
bioRxiv - Cell Biology 2021Quote: siRNA transfections were performed in mES cells with Lipofectamine 2000 (Thermo Fisher Scientific). mES cells were seeded into 12-well plate and cultured in LIF/2i medium for overnight ...
-
bioRxiv - Systems Biology 2020Quote: ... Transfection was performed by incubation of siRNA with Optimem Medium (Gibco, Life Technologies) and Lipofectamin RNAiMAX (Invitrogen ...
-
bioRxiv - Genetics 2020Quote: ... Each gene under study was targeted with a single siRNA (Silencer Select, Invitrogen) that had been selected with the EMBL-generated software tool bluegecko (J.K ...
-
bioRxiv - Microbiology 2021Quote: Vero81 cells were transfected with 10 nM of siRNAs using Lipofectamine RNAiMAX (Invitrogen) diluted in serum-free OPTI-MEM according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... siRNAs were transfected on day 1 and 3 with LipofectamineTM RNAiMAX (Thermo Fisher) and collected on day 8 for analysis ...
-
bioRxiv - Neuroscience 2019Quote: ... Two different siRNA products against JPH4 (Silencer Select, s175513 and s175511, Life technologies) as well as scrambled control (Silencer Select Negative Control No.1 ...
-
bioRxiv - Systems Biology 2020Quote: ... Transfection was performed by incubation of siRNA with Optimem Medium (Gibco, Life Technologies) and Lipofectamin RNAiMAX (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... Both the transfection method of CDK1 siRNA (cat.no. AM16708; Thermo Fisher Scientific, Inc.) into HEK293 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Transfections were done using either oligofectamine for siRNA transfection (Invitrogen P/N 58303) using 50 pmol of each siRNA or Lipofectamine 2000 ...
-
bioRxiv - Cell Biology 2021Quote: ... Plasmid DNA and siRNA transfections were performed using lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions.
-
bioRxiv - Biophysics 2020Quote: ... or 250 pmol of a scrambled control siRNA (Silencer Select, Life technologies; 4390843). Transfection was done using the SE Cell Line 4D-Nucleofector™ X Kit (Lonza) ...
-
bioRxiv - Cancer Biology 2021Quote: ... as follows: Lipofectamine RNAiMax and siRNA were diluted in Opti-MEM (Life Technologies) at appropriate concentrations ...
-
bioRxiv - Cell Biology 2020Quote: ... then transfected with 50 nM siRNA using Lipofectamine® RNAiMAX (Invitrogen, #13778-150). Cell s were fed with fresh full media 6 h later ...
-
bioRxiv - Cell Biology 2021Quote: ... GE Dharmacon) siRNA with 100-µl tips from Neon Transfection System (Thermo Fisher) (1,400 V ...
-
bioRxiv - Cell Biology 2021Quote: siRNAs targeting Golgi apparatus 37 morphology in this study were obtained from Ambion/ThermoFisher as Silencer Select reagents ...
-
bioRxiv - Cell Biology 2022Quote: siRNA transfection was performed using Lipofectamine RNAiMax Transfection Reagent (Thermo Fisher Scientific #13778150) in Opti-MEM Reduced Serum Media (Gibco #31985-062) ...
-
bioRxiv - Cell Biology 2022Quote: ... ORP5 or ORP8-specific siRNAs specified above by using Oligofectamine (Thermo Fisher Scientific). The cells were then washed and shifted into Hanks balanced salt solution (Gibco ...
-
bioRxiv - Biochemistry 2022Quote: ... The siRNAs were diluted in reduced serum media (Opti-MEM; Gibco, 31985-047). Transfection was performed using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and human DUOX1 siRNA (S28797) were obtained from Applied Biosystems (Carlsbad, CA, USA). DUOX2 siRNA ‘B’ (Cat# J-008324-05-0020 ...
-
bioRxiv - Cell Biology 2022Quote: ... All siRNAs/dsiRNAs were transfected using Lipofectamine® RNAiMAX Transfection Reagent (Thermo Fisher) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Dharmacon-ON-TARGETplus Human Wapl siRNA-SMARTpool) were transfected using RNAiMax (ThermoFisher, #13778100) transfection reagent according to the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2020Quote: ... Transfection of plasmid (10 µg) or 10-20 nM synthetic siRNA (Life Technologies) was performed using Lipofectamine® 2000 transfection reagent (Life Technologies ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were transfected with 25 nM siRNA oligonucleotides using Lipofectamine RNAiMAX (ThermoFisher Scientific) according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... Transfection of plasmids and siRNA was performed using Lipofectamine 3000 (Thermo Fisher Scientific) and Lipofectamine RNAiMAX (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2021Quote: siRNAs (1 pmol) were transfected into cells using Lipofectamine RNAiMAX transfection reagent (Invitrogen) 72-96 hours prior to infection with VEEV-TC-83-nLuc ...
-
bioRxiv - Cancer Biology 2021Quote: ... siRNA treatment using siAURKAIP1(Horizon) was performed using Lipofectamine 2000 (Thermofisher, cat#11668500) as per the manufacturer’s instructions.
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... siRNA reverse transfections were performed in 10 cm with Lipofectamine RNAiMAX (Thermo Scientific) at a final concentration of 20 nM siRNA (Eurogentec or Dharmacon ...
-
bioRxiv - Cell Biology 2022Quote: ... Transfection of siRNA was performed using Lipofectamine™ RNAiMax Reagent (Thermo Fisher Scientific), and cells were analyzed 48∼72h after siRNA transfection.
-
Molecular profiling of driver events and tumor-infiltrating lymphocytes in metastatic uveal melanomabioRxiv - Cancer Biology 2019Quote: ... The siRNA duplexes were purchased from Dharmacon (Thermo Fisher Scientific, Waltham, MA, USA) and the lipid based transfection was performed with Lipofectamine-RNAiMAX® (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were transfected with 40nM Sigma MISSION siRNAs (S3 Table) using RNAiMAX (Invitrogen), incubated in growth media for 24h ...
-
bioRxiv - Systems Biology 2019Quote: ... siRNAs was diluted in 125μL of reduced serum medium (OPTI-MEM I; Invitrogen). The Lipofectamine RNAiMax reagent was diluted in 125μL of OPTI-MEM I and the two solutions were then mixed and incubated for 10 minutes at room temperature before addition to the cells ...
-
bioRxiv - Cell Biology 2019Quote: Transfection with siRNAs was performed according to manufacturers’ instructions using RNAiMAX (ThermoFisher Scientific). We performed reverse transfection by seeding 80μl HeLa cells (2 x 103 cells/well ...
-
bioRxiv - Cell Biology 2019Quote: ... Transfections with siRNA were carried out with Lipofectamine RNAiMAX Transfection Reagent (ThermoFisher Scientific). Briefly ...
-
bioRxiv - Cancer Biology 2019Quote: ... Transfections of siRNAs were performed using the Lipofectamine RNAiMAX transfection reagent (Life Technologies). 150 000 cells were seeded in 6-well plated in 2 mL of antibiotics-free medium and transfected 24 hours later with 20nM of total siRNA ...