Labshake search
Citations for Thermo Fisher :
1501 - 1550 of 10000+ citations for 6 Cyano imidazo 1 2 a pyridine 2 carboxylic acid ethyl ester since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... RD114 cells were seeded at 2 × 105 cells/well in a 6-well plate with DMEM (Gibco, USA) supplemented with 10% FCS (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... Slides were washed five times in PBST and counterstained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, D1306) and mounted in Aqua-polymount (Polysciences Ince. ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 6 mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081), penicillin (100 U/μL) ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were marked with 2,3x10-3 µg/µL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 min at RT in the dark ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 6 mM L-glutamine (2 mM from Gibco 31600-091 and 4 mM from additional Gibco 25030-081), penicillin (100 U/μL) ...
-
bioRxiv - Cell Biology 2023Quote: ... For nuclear staining 0.5µg/µL of DAPI (4’, 6-diamidino-2-phenylindole, dihydro-chloride, Invitrogen. Cat. No.: D3571) was added along with secondary antibody ...
-
bioRxiv - Developmental Biology 2023Quote: ... ATs and TTs were fixed in 4% PFA and stained with 4′,6- diamidino-2-phenylindole (DAPI) (Invitrogen) to identify cell nuclei ...
-
bioRxiv - Microbiology 2024Quote: ... Then, 4′,6-diamidino-2-phenylindole (DAPI, Solabio) and Alexa Fluor 488 Conjugate Concanavalin-A (Invitrogen, CA, USA) were added to each slide and incubated for 5 min at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... metaphase II-arrested eggs were microinjected with 2-3 picolitres of Rec8 antiserum (13) (1:2 dilution) and Alexa Fluor 488 Dextran 10,000 MW (Molecular Probes, D22910; 1:40 dilution) in 0.05% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... F-actin was incubated for 2 h at room temperature with a fivefold molar excess of Alexa-488 NHS ester dye (Thermo Fisher Scientific, USA, cat: no: A20100). F-actin was pelleted by centrifugation at 450,000 × g for 40 min at room temperature ...
-
bioRxiv - Biophysics 2020Quote: 13) Alexa Fluor 647 NHS Ester (Succinimidyl Ester) (Thermo Fisher Scientific, Cat# A20106) ! CAUTION keep in dark at -20°C.
-
bioRxiv - Immunology 2020Quote: ... Alexa Fluor 488 NHS Ester (Succinimidyl Ester) and DAPI were purchased from ThermoFisher Scientific.
-
bioRxiv - Biochemistry 2022Quote: ... HItln1 was labeled with Alexa Fluor 647 NHS Ester (Succinimidyl Ester) (ThermoFisher Scientific) and MBL was labeled with Alexa Fluor 555 NHS Ester (Succinimidyl Ester ...
-
bioRxiv - Physiology 2022Quote: ... the fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG; 6.83 μg/kg BW, Invitrogen) dissolved in 50% dextrose (1 g/kg BW ...
-
bioRxiv - Neuroscience 2021Quote: ... the Ca+2 indicator Fluo-4-AM (Molecular Probes, Eugene, OR; 2–5 µl of 2 mM dye) were dropped over S1 cortex ...
-
bioRxiv - Immunology 2023Quote: ... Cells were then incubated for 30min at 37°C with 150µM of 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-2-deoxy-D-glucose (ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... we used 15 μL of a mixture of 4’,6-diamidin-2-phenylindole (4 μg mL−1) in SlowFade Gold Antifade Mounting medium (both Thermo Fisher Scientific, Waltham, MA, USA). All solutions and buffers for virus-targeted genomeFISH experiments were prepared with molecular grade water (Carl Roth ...
-
bioRxiv - Plant Biology 2020Quote: Lines with defective stomatal responses to at least one stimulus were subjected to sequencing of “usual suspects” either by NGS-based sequencing of PCR amplicons obtained with the use of gene-specific primers (Supplementary Data Set 2) and Phusion DNA polymerase (ThermoFisher Scientific; ROUND 1 to 6), or whole-genome sequencing (ROUND 7 and 8) ...
-
bioRxiv - Cell Biology 2021Quote: ... THP-1 cells (1.5×105 cells/mL) were labeled with a fluorescent dye 2’,7’-bis(carboxyethyl)-5 (6)-carboxyfluorescein-AM (Thermo Fisher Scientific B1150; 1 mg/mL) in serum-free RPMI medium (Thermo Fisher Scientific 11875093 ...
-
bioRxiv - Cancer Biology 2021Quote: ... followed by 4’,6diamidino-2-phenylindole (DAPI, 1:300, Invitrogen) staining for 10 min ...
-
bioRxiv - Neuroscience 2021Quote: ... 2°: goat anti-mouse AF488 (1:500) (Invitrogen, A-11001), and donkey anti-rabbit Cy5 (1:200 ...
-
bioRxiv - Neuroscience 2021Quote: ... and ethidium homodimer-1 (2 mM in DMSO, L3224, ThermoFisher) were added directly to the cell medium to a final concentration of 1 μM each ...
-
bioRxiv - Neuroscience 2021Quote: ... stained with Neurotrace for 2 hours (1:500, N21479; Invitrogen), rinsed twice with 2x SSCT and mounted on a slide with Fluoromount-G ...
-
bioRxiv - Microbiology 2019Quote: ... N-2 supplement (1:200; catalog number 17502-048; Invitrogen), 20 ng/ml fibroblast growth factor (catalog number 4114-TC-01M ...
-
bioRxiv - Molecular Biology 2020Quote: ... and HA tag (2-2.2.14; ThermoFisher Scientific 26183, 1:10,000), used with goat anti-mouse IgG AlexaFluor®568 (ThermoFisher Scientific A-11004 ...
-
bioRxiv - Microbiology 2019Quote: ... supplemented with 1% penicillin-streptomycin with 2 mM glutamine (Invitrogen), 2% B27 (Invitrogen) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were loaded with 1 μM fura-2 AM (Invitrogen) for 40 min before the measurements at 37°C ...
-
bioRxiv - Bioengineering 2021Quote: ... 1-2 drops of CytoSeal mounting media (Thermofisher, 8312-4) was placed on each slide ...
-
bioRxiv - Bioengineering 2021Quote: ... 1 ng/mL human FGF-2 (ThermoFisher #68-8785-63), and 1% Primocin (Invivogen #ant-pm-1 ...
-
bioRxiv - Neuroscience 2020Quote: ... 1% L-glutamine and 2% penicillin/streptomycin (Invitrogen, Paisley, UK). All cells were incubated at 5% CO2 in a humidity-controlled environment (37°C ...
-
bioRxiv - Microbiology 2020Quote: ... transfection reagent (1:2 µg:µL ratio) in Opti-MEM (Gibco), serial diluted in 4-fold increments (1µg to 0.016µg RNA final) ...
-
bioRxiv - Neuroscience 2020Quote: ... 2) streptavidin conjugated with Alexa Fluor488 (1:1000) (Thermofisher Science), or 3 ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 μg GFP plasmid and 2 μl Lipofectamine 2000 (Thermofisher) with DNA:reagent ratio 1:2 were added into 25 μl of DMEM media in separate with DNA:reagent ratio 1:2 were added into 25 μl of DMEM media in separatetubes and incubated for 5 min at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... 2 mM L-glutamine and 1 mM sodium pyruvate (Gibco). SK-N-SH and MNA Cells were maintained at 37 °C with 5% CO2.
-
bioRxiv - Systems Biology 2022Quote: ... ExpiFectamine 293 Transfection Enhancer 1 and Enhancer 2 (Thermo Fisher) were added to the cells ...
-
bioRxiv - Physiology 2022Quote: ... ExpiFectamine 293 Transfection Enhancer 1 and Enhancer 2 (Thermo Fisher) were added ...
-
bioRxiv - Genetics 2022Quote: ... 2 μL SYBR green I diluted 1:10,000 (Life Technologies) and 0.5 uM of TruSeq_Universal_Adapter (AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT ...
-
bioRxiv - Developmental Biology 2019Quote: ... rat anti-E-Cadherin (Invitrogen clone ECCD-2, 1:500), rabbit anti-PH3 (Millipore ...
-
bioRxiv - Cell Biology 2019Quote: ... 4,6-diamino-2-phenylindole (DAPI) dihydrochloride (1:10,000, Life Technologies) was used to counterstain the nucleus/chromosomes ...
-
bioRxiv - Genomics 2019Quote: ... 1 µl of 2 U/µl E Coli RNaseH (Invitrogen) and then incubating at 16°C for 2 hours ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µL of 1 U/µL alkaline phosphatase (Thermo Fisher) and 10 µL 10 x alkaline phosphatase buffer was added and incubated at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... supplemented with 1% penicillin-streptomycin with 2 mM glutamine (Invitrogen), 2% B-27 (Gibco) ...
-
bioRxiv - Physiology 2021Quote: ... with 2 μM JC-1 dye (M34152, Thermo Fisher Scientific) at 37 °C in a 5% CO2 incubator for 20 minutes ...
-
bioRxiv - Immunology 2020Quote: ... 1% Penicillin-Streptomycin and 0.1% 2-mercaptoethanol (50 mM; Gibco) (cRPMI) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and diamidino-2-phenylindole (DAPI) (1:500, Thermo Scientific, 62247).
-
bioRxiv - Microbiology 2021Quote: ... BMDMs were treated with 1 mM 2-DG (Life Technologies) dissolved in medium without glucose for 2h prior to infection ...
-
bioRxiv - Bioengineering 2021Quote: ... 2 ng mL−1 bFGF (Cat. no. 233FB025CF, Fisher Scientific), and 10 μM all-trans retinoic acid (Cat ...
-
bioRxiv - Immunology 2021Quote: ... diluted 1:2 with PBS with Ca2+Mg2+ (Thermo Fisher) was added to the cells and incubated in the dark for 15 min before reading on a Synergy H1 Hybrid Multi-Mode plate reader (Biotek) ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... 1% Penicillin-Streptomycin and 55 µM 2-Mercaptoethanol (all Gibco) supplemented with 4% FLT3L supernatant (generated from the cell line CHO flag Flk2.clone5 kindly provided by Prof Nic Nicola ...
-
bioRxiv - Immunology 2020Quote: ... 1% Penicillin-Streptomycin and 0.1% 2-mercaptoethanol (50 mM; Gibco) (cRPMI) ...