Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 7888 citations for Recombinant Human STXBP3 His & GST tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... injections also contained 1 μg of recombinant murine IL-2 (Gibco). PBS was used as vehicle.
-
bioRxiv - Immunology 2024Quote: ... used for recombinant protein production were maintained in FreeStyle (ThermoFisher, #12338026) or Expi293 media (ThermoFisher ...
-
bioRxiv - Synthetic Biology 2023Quote: All recombinant proteins were produced in Expi293F cells (Thermo Fisher Scientific) by transient transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant murine pro-CtsK were expressed in 293-Freestyle cells (ThermoFisher) by transient expression using FectoPRO transfection reagent (Polyplus transfection) ...
-
bioRxiv - Biophysics 2024Quote: ... The recombinant DR2539 was expressed in Escherichia coli BL21 (DE3) (Invitrogen). The cells were grown at 310 K to an OD600 of ≈ 0.6 in Luria-Bertani medium containing 100 µg ml-1 of ampicillin ...
-
bioRxiv - Biochemistry 2022Quote: All recombinant proteins were expressed in Escherichia coli BL21 DE3 (Invitrogen), in LB medium ...
-
bioRxiv - Immunology 2023Quote: Recombinant gp120s were produced via transient transfection using Freestyle 293F (ThermoFisher) or 293S GnT1- cells and 293Fectin using the same conditions as SOSIP gp140s ...
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Genetics 2023Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing ApcKO colon organoids ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Cell Biology 2024Quote: ... RNaseOUT Recombinant Ribonuclease Inhibitor (40 U/1 µL, Thermo Fisher Scientific), Universal RNA Spike II (0.005 ng/µL ...
-
bioRxiv - Biophysics 2024Quote: Recombinant baculoviruses were produced using the Bac-to-Bac system (Invitrogen) and infected Spodoptera frugiperda (Sf9 ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant plasmids were transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen) together with lentiviral packaging vectors pMD2.G and psPAX2 (gifts from Didier Trono ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.5 uL Taq DNA Polymerase Recombinant (5u/ uL) (Invitrogen, Catalog #10342020), and 0.5 uL dsH2O to a total of 22.5 uL ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human transferrin-568 (ThermoFisher) was added at 10μg mL−1 concentration in serum free media and incubated at 37°C to allow for internalization ...
-
bioRxiv - Immunology 2021Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Cancer Biology 2022Quote: Probes Hs00171064_m1 (human, ThermoFisher), Mm00440280_g1 (mouse ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary human hepatocytes (Gibco) were seeded in the top channel at a density of 3.5 x 106 cells/mL using complete hepatocyte seeding media ...
-
bioRxiv - Immunology 2020Quote: ... or anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 25 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... or human IgG (Invitrogen) as control ...
-
bioRxiv - Bioengineering 2022Quote: ... and human fibronectin (Gibco) at 50 μg/mL in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... human (ThermoFisher Scientific, 902927). Analysis was performed with Transcriptome Analysis Console 4.0 software (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Immunology 2024Quote: ... Anti-Human-HRP (Invitrogen) was diluted 1:5000 in 1% BSA/PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... CD36 (Human tissue Thermofisher: PA1-16813 1:500 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% human IgG (Invitrogen) in PBS] followed by incubation with primary antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... human plasma (ThermoFisher, #33016015); Laminin 111 ...
-
bioRxiv - Immunology 2023Quote: ... A Human ProcartaPlexTM (Invitrogen) immunoassay was additionally used to detect 45 human cytokines ...
-
bioRxiv - Cancer Biology 2024Quote: ... human CD3-PE (Invitrogen), and mouse CD45-erpCP Cy5.5 (BD Biosciences ...
-
bioRxiv - Developmental Biology 2021Quote: ... C2cd6s was subcloned into pcDNA3.1/myc-His A vector (Cat. No. V800-20, Invitrogen). The others were TA-cloned to pcDNA3.1/V5-His TOPO TA vectors (Cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the Ion PI™ Hi-Q™ OT2 200 kit (Invitrogen; Cat #A26434) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... incubated with DPBS containing 10% HI FBS and 1:1000 Hoechst 33342 (Invitrogen, #H3570) for nuclear staining and mounted onto microscope cover slips with Fluoromount G (Southern Biotech ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 10% heat-inactivated fetal bovine serum [HI-FBS] (Cat#SH30071.03, Thermo Scientific), penicillin [100 IU/ml]-streptomycin [100 ug/ml] (Quality Biological ...
-
bioRxiv - Molecular Biology 2019Quote: ... BAC DNA extraction was performed using Hi-Pure Plasmid DNA Extraction Kit (Invitrogen K210017). Nick translation of BAC DNA was performed using the Nick Translation kit (Roche 11 745 808 910) ...
-
bioRxiv - Molecular Biology 2019Quote: ... full-length MmEsco2 was cloned into the pcDNA3.1/myc-His vector (Thermo Fisher Scientific). Subsequently ...
-
bioRxiv - Microbiology 2019Quote: ... 6×His-Lsr2 was purified by binding to 1 mL Ni-NTA agarose (Invitrogen), after which the resin was collected and the bound protein was washed with binding buffer supplemented with increasing concentrations of imidazole ...
-
bioRxiv - Immunology 2021Quote: ... The extracellular domain of NKp46 was cloned into pcDNA Myc-His 3.1a vector (Invitrogen) or pCMV vector (Addgene plasmid #59314 ...
-
bioRxiv - Bioengineering 2020Quote: ... rabbit monoclonal anti-6x-His tag at 1:1,000 (Thermo Fisher Scientific, MA5-33032), and mouse monoclonal anti-β-actin at 1:10,000 (R&D Systems ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cleared lysate was incubated with 1mL His-Pur nickel-NTA resin (Thermo Fisher) with rotation at 4 °C for 1 hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... ZAP-S and ZAP-L were subcloned into pEF1-V5/His (Thermo Fisher Scientific) via the KpnI/XbaI sites to generate pEF1-ZAP-S-V5/His and pEF1-ZAP-L-V5/His ...
-
bioRxiv - Neuroscience 2022Quote: ... the pEx-FGD4-His-V5 vector was generated by Gateway cloning technology (Thermofisher, USA). Transfection experiments were performed using promofectin reagent (#PK-CT-2000-50 ...
-
bioRxiv - Microbiology 2022Quote: ... or membrane probed with mouse monoclonal 6x-His tag antibody (4A12E4) (Thermofisher, Waltham, MA) (Supplementary Figure 2).
-
bioRxiv - Immunology 2022Quote: ... unbiotinylated form were incubated with 2μg/mL anti-His biotin (Invitrogen, MA1-21315-BTIN) for 20 min at room temperature before being used to label the streptavidin beads ...
-
Assessment of Human Renal Transporter Based Drug-Drug Interactions Using Proximal Tubule Kidney-ChipbioRxiv - Cell Biology 2022Quote: ... Heat inactivated fetal bovine serum (HI FBS) and trypan blue were procured from Gibco Life Technologies (Waltham ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 10% heat inactivated fetal bovine serum (HI-FBS, Life Technologies unless indicated), 100 U/mL penicillin-streptomycin ...