Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 6035 citations for Hemoglobin subunit zeta HBAZ Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... interleukin-6 and -8 (IL-6 and IL-8) human Instant Elisa™ kits and matrix metalloproteinase-1 (MMP-1) human Elisa kit from ThermoFisher Scientific.
-
bioRxiv - Immunology 2022Quote: ... and activated for 48h with 30 U/ml human IL-2 and anti-CD3-anti-CD28-beads (Dynabeads™ human T-Activator CD3/CD28, ThermoFisher). Retroviral packaging cells RD114 were seeded to reach a confluency of 60% on the day of transfection and subsequently transfected with plasmids containing the neoTCR-α- and -β-chain-sequences using TransIT®-293 (MirusBio) ...
-
bioRxiv - Immunology 2023Quote: ... plates were washed and incubated for one hour with SULFO-TAG conjugated anti-human IgG for mAbs (MSD) or SULFO-TAG conjugated polyclonal anti-human IgG+A+M (Thermo Fisher) for serum samples ...
-
bioRxiv - Cancer Biology 2023Quote: ... The cell binding experiment was done with the human T lymphocyte cell Jurkat and anti-human IgG antibody-Ax488 (ThermoFisher Scientific). Ax488 signal changes upon binding were detected using a flow cytometer (BD Accuri C6 ...
-
bioRxiv - Immunology 2023Quote: ... Human serum used for all conditions was from the same lot of pooled human AB serum (Fisher Scientific, Cat#: BP2525-100). For heat inactivation ...
-
bioRxiv - Immunology 2024Quote: ... blocked then incubated overnight at 4°C in primary antibody (rabbit anti-human STAT1 1:500, HPA000931, Sigma-Aldrich; mouse anti-human pSTAT1 1:1000, 33-3400, Invitrogen; mouse anti-human STAT2 ...
-
bioRxiv - Cell Biology 2023Quote: HCT116 human colorectal cancer and SUIT-2 human pancreatic ductal adenocarcinoma cells were grown in McCoy’s 5A medium (Gibco, Cat. # 26600080) supplemented with 10% v/v dialyzed Foetal Bovine Serum (FBS ...
-
bioRxiv - Developmental Biology 2024Quote: ... Flow cytometry was used to evaluate the efficiency of differentiation to definitive endoderm at day 3 using the endoderm markers CXCR4 and c-KIT (Anti-human CXCR4 PE conjugate, Thermo Fisher, MHCXCR404,1:20; Anti-human c-kit APC conjugate, Thermo Fisher, CD11705 ...
-
bioRxiv - Plant Biology 2019Quote: ... pEF1-MCS-3Myc [BamHI-NotI-3Myc-stop fragment was inserted between KpnI and XbaI sites of pEF1/myc-His B vector (Invitrogen)] was generated ...
-
bioRxiv - Microbiology 2020Quote: The parB genes were recombined into a Gateway-compatible destination vector pET-His-MBP-TEV-DEST 56 via an LR recombination reaction (ThermoFisher). For LR recombination reactions ...
-
bioRxiv - Developmental Biology 2021Quote: ... was modified by replacement of the SV40 promoter by the Drosophila actin promoter from the pAct5.1/V5-His C vector (Thermo Scientific), and the firefly luciferase coding sequence by the Renilla luciferase (RLuc ...
-
bioRxiv - Microbiology 2022Quote: ... The two pAcgp67-RBD (residues 333–530) plasmid with a C-terminal 8×His tag were transfected into Sf9 cells using Cellfectin II Reagent (Invitrogen) to produce the recombinant baculoviruses ...
-
bioRxiv - Molecular Biology 2020Quote: 6xHis-tagged REV-ERBβ LBD (4 nM) was incubated with anti-His antibody conjugated to terbium (1 nM) (ThermoFisher #PV5863) and FITC-labeled NCoR ID1 or NCoR ID2 peptide (400 nM ...
-
bioRxiv - Bioengineering 2022Quote: ... supernatants were harvested and filtered with a 0.22 µm membrane.The His-tagged proteins were purified with the HisPur Ni- NTA Resin (Thermo Fisher, 88222). After three columns of washing with 25 mM Imidazole (pH 7.4) ...
-
bioRxiv - Immunology 2022Quote: Recombinant soluble ICAM-1 protein was expressed in a Drosophila Melanogaster cells using pMT/V5-His vector with inducible promotor (Invitrogen), purified by sequential two-step affinity chromatography on anti-ICAM-1 antibody (clone YN1.1 ...
-
bioRxiv - Immunology 2021Quote: ... The efficiency of the expression and purification of recombinant proteins were evaluated by 12% SDS-PAGE and Western blotting by using anti-his tag antibodies (1:3,000) (Thermo Scientific) and HRP-conjugated goat anti-mouse IgG (1:10,000 ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was cloned between 5’ KpnI and 3’ EcoRI sites of the pMT/V5-His vector (Invitrogen). In-frame Tag-RFP-T gene was then introduced at the 3’ end of γ-tubulin gene between 5’ EcoRI and 3’ NotI sites ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting PCR product was then inserted into the 5’ SpeI and 3’ EcoRI sites of the pMT/V5 His-B vector (Invitrogen) containing in-frame mTurquoise2 gene at the 5’ end ...
-
bioRxiv - Biochemistry 2019Quote: ... the polynucleotides encoding GtACR1 mutants were fused in frame with a C-terminal eight-His tag and subcloned into the pPIC9K vector (Invitrogen) between EcoRI and NotI sites ...
-
bioRxiv - Bioengineering 2019Quote: ... precipitate and soluble of was checked for the expression by SDS-PAGE and confirmed indirectly by Western blot with anti-his antibody (Invitrogen).
-
bioRxiv - Cell Biology 2019Quote: ... 1-2 μg His-tagged calcineurin was first bound to Ni-NTA-agarose or magnetic Dynabeads (Thermo Fisher Sci. USA) in base buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Biochemistry 2019Quote: ... mCherry-(backbone pLV-CMV-bc) and FLAG-His-tagged(backbone Pcdna3) p16INK4A constructs were created using gateway technology (Life Technologies). For cell cycle profiling ...
-
bioRxiv - Synthetic Biology 2019Quote: ... An anti-6His antibody (6x-His Tag Polyclonal Antibody) and an anti-HA antibody (HA Tag Polyclonal Antibody) were purchased from Invitrogen. Western blot analysis was conducted as described previously 45.
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... The BglII and EcoRI restriction sites were used to insert the sequence into the pMT/BIP/V5-His plasmid (ThermoFisher). The production of recombinant IrSPI protein was performed by the Recombinant Proteins in Eukaryotic Cells Platform ...
-
bioRxiv - Molecular Biology 2019Quote: ... Emulsion PCR was performed using the Ion PGM Hi-Q View OT2 Kit and the Ion OneTouch 2 system (ThermoFisher). Template-positive ion sphere particles (ISPs ...
-
bioRxiv - Molecular Biology 2019Quote: ... Enriched ISPs were loaded on a PGM 314R v2 chip and sequenced using the Ion PGM Hi-Q View Sequencing Reagents (ThermoFisher). Raw sequencing data were processed using the Torrent Suite software v5.0 (ThermoFisher) ...
-
bioRxiv - Genomics 2021Quote: ... TaTLP2-B gene was re-amplified from the confirmed clone using the same primers and ligated into the pYES2.1/V5-His-Topo vector (Invitrogen, USA). The recombinant plasmid (pYES2.1-TaTLP2-B ...
-
bioRxiv - Immunology 2021Quote: ... each mouse Siglec gene containing 2-3 domains with pairs of forward and reverse primers (Table S5) were cloned into pcDNA5/FRT/V5-His-TOPO vector (Invitrogen), which contained a C-terminal hIgG1-Fc ...
-
bioRxiv - Microbiology 2021Quote: ... with a N-terminal gp67 signal peptide for secretion and a C-terminal 6×His tag for purification was inserted into pFastBac-Dual vector (Invitrogen). The recombinant baculoviruses were generated according to the manufacture’s instruction to infect Hi5 cells at a density of 2×106 cells/ml ...
-
bioRxiv - Biophysics 2021Quote: The bacteriophage T7 gp15 gene was inserted into the pRSET-B vector (ampr and 6x-His tag) from Invitrogen (USA), between the XhoI and EcoRI restriction sites ...
-
bioRxiv - Bioengineering 2021Quote: ... supernatants were harvested and filtered with a 0.22 μm membrane.The His-tagged proteins were purified with the HisPur Ni-NTA Resin (Thermo Fisher, 88222). After three columns of washing with 25 mM Imidazole (pH 7.4) ...
-
bioRxiv - Biochemistry 2020Quote: ... the opsin-encoding constructs were fused in frame with a C-terminal eight-His tag and subcloned into the pPIC9K vector (Invitrogen). Mutants were generated with Quikchange XL kit (Agilent Technologies ...
-
bioRxiv - Biochemistry 2020Quote: ... with a N-terminal 8x His tag was expressed from the pSJ2 vector (84) in BL21 E.coli and purified by Ni-NTA resin (Thermo Fisher). Full-length human Src kinase (WT or K298M ...
-
bioRxiv - Neuroscience 2020Quote: ... for 48 h then transfected for 24 h with 1 ug His-G3BP1 3’UTR constructs using Lipofectamine LTX and Plus reagent (Invitrogen). To determine mRNA stability ...
-
bioRxiv - Cancer Biology 2021Quote: ... Biotinylated RNA baits were used in a ratio 1:12 to Hi-C libraries (25 ng biotinylated RNA baits per 300 ng of Hi-C library) and supplemented with 30 units SUPERase-In (Ambion). Biotinylated RNA baits for capture DNA-Seq were used in a ratio of 1:3.33 (300 ng RNA baits per 1,000 ng genomic DNA library ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 ml of Dynal sheep-anti mouse IgG paramagnetic beads were non-covalently coupled with 60 µg of anti-His mAb (Invitrogen) in PBS plus 0.1% immunoglobulin-free BSA (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... M-OPG2 and S-OPG2 were generated by inserting the respective cDNAs in frame between NheI and AflII sites of a pcDNA5/FRT/V5-His vector (Invitrogen) containing a C-terminal OPG2 tag (MNGTEGPNFYVPFSNKTG) ...
-
bioRxiv - Cell Biology 2021Quote: qPCR analysis was performed using the LabTaq Green Hi Rox (Labtech) following manufacturer’s instructions on a QuantStudio 6 Flex Real-Time PCR System (Applied Biosystems) and primers listed in Supplementary Table S4.
-
bioRxiv - Plant Biology 2021Quote: ... fused with a six-HIS tag at the C-terminus were expressed using the Bac-to-Bac baculovirus expression system (Invitrogen) in High Five cells at 22 °C as reported previously 23 ...
-
bioRxiv - Microbiology 2021Quote: ... Amplified fragments were digested with KpnI and XhoI and cloned into the pre-cut pcDNA4/myc-His A vector (Invitrogen) by using the DNA ligation Kit (Takara) ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Molecular Biology 2022Quote: ... with FLAG sequence flanking at 5’ end of the primer and cloned in Hind III and Xba I site of pCDNA3.1V5-His (Invitrogen, USA). Clones were sequenced with T7 and BGH primer using ABI BigDyeTerminator V3.1 cycle sequencing kit followed by automated sequencing in ABI 3130 Genetic Analyzer according to manufacturer’s protocol.
-
bioRxiv - Microbiology 2019Quote: ... 1 nM of CAT protein (Chloramphenicol acetyltransferase, containing a 6×His tag at C-terminus) expressed in the same baculovirus-expression system (ThermoFisher) was used to coat plate wells ...
-
bioRxiv - Microbiology 2020Quote: ... 2015) were produced from C6/36 cell line cultured in L-15 (HyClone) supplemented with 1.5% HI-FBS (ThermoFisher Scientific), 10% tryptose phosphate ...
-
bioRxiv - Cell Biology 2022Quote: The cDNA coding for fibulin1C (Uniprot number P23142-4) with a C-terminal 6x His tag was custom-synthesized by Invitrogen and transiently transfected in HEK293 T cells using polyethylenimine in OPTIMEM (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... F 5’-GAACTGTCCAGATGCCCTTCCAGTT-3’ and R 5’-GCATCTGGACAGTTCTGGGAAGCCCG-3’) was cloned by PCR and ligated into the pEF6/V5-His TOPO plasmid vector (Invitrogen). FBLN7-V5-His vector was transfected into CHO cells (FBLN7-CHO ...
-
bioRxiv - Cell Biology 2022Quote: His- and GST-tagged CFAP418 proteins were expressed in One Shot™ BL21 Star™ (DE3) cells (ThermoFisher, Waltham, MA) and purified using HisPur™ Ni-NTA resin and Pierce™ Glutathione Superflow Agarose ...
-
bioRxiv - Microbiology 2022Quote: ... A recombinant SPATR (rSPATR) fused to a polyhistidine tag (His-tag) was produced in BL21-CodonPlus-RIL competent cells (Invitrogen) and protein purification was performed under denaturing conditions using Ni-NTA Agarose (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... cell lines were maintained in Ham’s F12 media (Hi Media, India) supplemented with (10%) fetal bovine serum (FBS, Gibco, USA). Plasmids were either expressed stably (FR-GPI ...
-
bioRxiv - Microbiology 2020Quote: ... using the primers in Table II and after digestion with BamHI and XhoI was cloned into pCDNA™3.1/myc-His A (Invitrogen). CHIKV structural genes were initially PCR amplified from pDONR21-CHKVstr (60 ...