Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 6574 citations for GDF 11 BMP 11 Human HEK293 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: Cultured HEK293 cells were grown on 12 mm round cover glasses (Azer Scientific, #200121) pre-coated with poly-D-lysine (Gibco, #A3890401) in 24-well plates and then transfected with a plasmid encoding HA-tagged neurexin1 alpha using lipofectamine 2000 ...
-
bioRxiv - Immunology 2024Quote: ... We electroporated 3 μg of ODNs or gDNA into 2 × 106 HEK293 and 293A cells by Neon Transfection System (Thermo Fisher) based on the manufacturer’s introductions.
-
bioRxiv - Physiology 2023Quote: Cell surface proteins from transfected HEK293 cells were biotinylated using the Pierce Cell Surface Protein Isolation Kit (ThermoFisher Scientific., cat# 89881). Briefly ...
-
bioRxiv - Biochemistry 2024Quote: ... A549 and the HEK293 cell line stably transduced with a firefly luciferase reporter under the control of a synthetic NF-κB promoter (HEK293-NF-κB_luc, BPS-Bioscience) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco, Cat# 61965-026) supplemented with 10 % fetal calf serum at 37 °C in a 5 % CO2 incubator.
-
bioRxiv - Immunology 2022Quote: ... All soluble SOSIP Envs were expressed by transient transfection in HEK293-6E cells (National Research Council of Canada) or Expi293 cells (Life Technologies) and purified from transfected cell supernatants by 2G12 affinity chromatography ...
-
bioRxiv - Cancer Biology 2023Quote: ... Constructs carrying the 3’UTRs were transiently co-transfected with vectors carrying Renilla-Luciferase and either miR-122 mimic (122-MIM) or scramble oligos (SCR) into HEK293 cells with Lipofectamine RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: HEK293 cells were harvested and lysed in RIPA lysis with 1X Halt™ Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific). The concentration of total protein was determined using the BCA Protein Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... and human embryonic kidney 293 cells (HEK293) were purchased from ATCC and cultured in Dulbecco’s Modified Eagle Medium (DMEM) high glucose (Fisher Scientific, #MT10013CV) with 10% FBS at 37 °C and 5% CO2 ...
-
bioRxiv - Molecular Biology 2023Quote: Approximately 4 × 106 HEK293 Flp-In T-Rex cells with EGFP integrants were seeded in 15-cm dishes (Thermo Fisher Scientific) and incubated overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... including Camuiα were transfected into HEK293S GnTI-cells (2 x 106 cells per well in 6-well plates) cultured in FreeStyle 293 (Thermo Fisher), using the TransIT2020 transfection reagent (Mirus Bio) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Culture inserts were removed 8h prior to imaging and HEK293 culture medium was changed to imaging medium – phenol red-free DMEM (Gibco, #31053028) with 10% FCS (Biosera ...
-
bioRxiv - Cell Biology 2023Quote: ... Flp-In HEK293 cells were co-transfected with the pCDNA3-TurboID-cyclin F plasmid and the pOG44 Flp-Recombinase Expression Vector (Invitrogen, V600520) for co-expression of the Flp-recombinase using Lipofectamine 2000 transfection reagent (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Cot-1 DNA (Invitrogen), 3M NaAc and 100% cold EtOH ...
-
bioRxiv - Cancer Biology 2024Quote: Recombinant human EGF (Gibco #PHG0311) was added to the medium of NCI-H23 or H23 KO cells at 80% confluency to reach a final concentration of 100 ng/mL ...
-
bioRxiv - Cancer Biology 2024Quote: ... Human Pool Set v3.0 (Thermofisher) and TaqMan™ MicroRNA Reverse Transcription Kit (Thermofisher) ...