Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 8012 citations for 7 CHLOROHEPTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... formic acid and trifluoroacetic acid (TFA) were liquid chromatography-mass spectrometry (LC-MS) grade solvents (Thermo Fisher Scientific, US). Ethanol was analytical grade (Chem-Supply ...
-
bioRxiv - Microbiology 2022Quote: Nucleic acid extraction was carried out using the MagMAX CORE Nucleic Acid Purification Kit (Applied Biosystems, Thermo Fisher Scientific). A pre-treatment step using bead beating tubes from MagMAX CORE Mechanical Lysis Module was introduced to improve DNA recovery ...
-
bioRxiv - Microbiology 2022Quote: Nucleic acid extraction was carried out using the MagMAX CORE Nucleic Acid Purification Kit (Applied Biosystems, Thermo Fisher Scientific). A pre-treatment step using bead beating tubes from MagMAX CORE Mechanical Lysis Module was introduced to improve DNA recovery ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.5% acetic acid) and solvent B (80% acetonitrile, 0.5% acetic acid) into an Orbitrap Eclipse mass spectrometer (Thermo Scientific). High resolution full MS spectra were acquired with a resolution of 120,000 ...
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... amino acids 23-429) or pro- BMP10 (NP_055297.1, amino acids 22-424) was cloned into pcDNA3.1+ (Invitrogen/Thermo Fisher Scientific) downstream of the rat serum albumin signal peptide ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.8 mM KH2PO4, 20 mM NaHCO3, 1.3 mM L-glutamine, 0.2 mM ascorbic acid, MEM amino acids solution [Thermo Fisher] ...
-
bioRxiv - Genetics 2024Quote: ... and 1 mM Ethylenediaminetetraacetic acid [EDTA]) containing 0.01% MilliporeSigma™ GelRed™ Nucleic Acid Stain (Fisher Scientific, catalog # SCT123) with electrophoresis performed at 200V for 30 minutes to detect the 604 bp transgene amplicon ...
-
bioRxiv - Immunology 2024Quote: ... and 1 mM Ethylenediaminetetraacetic acid [EDTA]) containing 0.01% MilliporeSigma™ GelRed™ Nucleic Acid Stain (Fisher Scientific, catalog # SCT123) with electrophoresis performed at 65V for 1 hour to detect the 230 bp transgene amplicon ...
-
bioRxiv - Microbiology 2020Quote: ... The position of the Nucleic acids was visualized by chemiluminescent detection using the Chemiluminescent Nucleic Acid Detection Module (Thermo Scientific) following manufacturer’s instructions and exposed to X-ray film (Amersham hyperfilm ECL ...
-
bioRxiv - Immunology 2022Quote: ... for 3 min and incubated in 1% phosphomolybdic acid then acetic acid solution (A38C-212; Thermo Fisher Scientific, Waltham, MA) for 5 min and 3 min ...
-
bioRxiv - Cancer Biology 2022Quote: ... the samples were reconstituted in 6 uL 0.1% formic acid (FA) 0.05% heptafluorobutyric acid (HFBA) (Thermo Fisher Scientific, cat. 25003).
-
bioRxiv - Neuroscience 2023Quote: ... the brain was stained with a nucleic acid stain (Sytox, green nucleic acid stain, 1:5000, ThermoFisher Scientific, cat. S7020). The brain was imaged on an LCS Spim light-sheet microscope (Bruker) ...
-
bioRxiv - Genomics 2023Quote: ... 0.10% (v/v) formic acid in water and (B) 0.10% (v/v) formic acid in acetonitrile (LC-MS optima, Fisher Scientific). Gradient conditions were as follows ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were washed 2 X in PBS and incubated in RPMI without amino acids (US Biological) for 1 h and then were shifted to RPMI with MEM Amino Acids (Gibco) at the indicated times ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the manufacturer’s protocol was used with a substitution of 0.1% trifluoroacetic acid (TFA) with 0.1% formic acid (Optima LC/MS grade, Thermo Fisher Scientific).
-
Shear stress and very low levels of ligand synergize to activate ALK1 signaling in endothelial cellsbioRxiv - Cell Biology 2023Quote: ... amino acids 23-429) or pro- BMP10 (NP_055297.1, amino acids 22-424) was cloned into pcDNA3.1+ (Invitrogen/Thermo Fisher Scientific) downstream of the rat serum albumin signal peptide ...
-
bioRxiv - Cell Biology 2024Quote: ... Amino acid starvation media was prepared based on Gibco standard recipe omitting all amino acids and supplemented as above without addition of non-essential amino acids and substitution with dialysed FBS (Invitrogen). Media was changed 24 h before experiments.
-
bioRxiv - Plant Biology 2020Quote: General ROS were detected using 2’-7’-dichlorodihydrofluorescein diacetate (CM-H2DCFDA, Invitrogen). CM-H2DCFDA was dissolved in DMSO to give a concentration of 1 mM and further diluted to a final concentration of 50 μM in water ...
-
bioRxiv - Plant Biology 2019Quote: ... using a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). The expression levels were calculated with the 2−ΔΔCt method ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 million primary neurons were plated on 60 mm culture dishes (ThermoFisher) and cultured for 7 days ...
-
bioRxiv - Cell Biology 2019Quote: MSFs were transfected with mRuby-Lifeact-7 using Lipofectamine 3000 (Life Technologies) 18 h after seeding into stretch chambers ...
-
bioRxiv - Cell Biology 2020Quote: ... [7] in the presence of 1X Halt protease inhibitor cocktail (Thermo Scientific) and protein quantified using the DC BioRad assay ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were run on the ViiA 7 thermocycler (Thermo Fisher Scientific) using standard cycling parameters provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and ran on a ViiA 7 Real-Time PCR System (ThermoFisher Scientific), with a 15-second 95°C denaturation step and a 1-minute 60°C annealing/extension step for 40 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... and 1 mM TCEP) with Zeba 7 kDa MWCO spin columns (ThermoFisher), re-quantified by A280 absorbance ...
-
bioRxiv - Developmental Biology 2021Quote: ... Plates were run on a ViiA-7 Real-Time PCR system (ThermoFisher), and CT values were auto-determined by the ViiA-7 software ...
-
bioRxiv - Immunology 2022Quote: ... on an ABI ViiA 7 Real-Time PCR system (Thermo Fisher Scientific). Forward and reverse primer sets were designed using NCBI Primer-Blast software and purchased from Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2022Quote: The cell-permeant reagent H2DCFDA (2’, 7’-dichlorodihydrofluorescein diacetate) (Thermo Fisher Scientific) was employed to represent the ROS levels in HeLa cells ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qPCR was run on Viia 7 RT-PCR system (Applied Biosystems). The fold-changes in gene expression were calculated by ΔΔCt method ...
-
bioRxiv - Immunology 2019Quote: PBMCs from 7 healthy donors were incubated with ATP (Invitrogen, 6.7 mM), adenosine (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the QuantStudio™ 7 Flex Real-Time PCR System (Life Technologies). ESRP1 was detected using (ESRP1 for AGCACTACAGAGGCACAAACA ...
-
bioRxiv - Immunology 2019Quote: ... CellEvent® Caspase-3/7 Green Detection Reagent (Thermal Fisher Scientific, C10423); CellTrace™ Violet (Thermo-Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... The reaction was carried out on a thermocycler (ViiA 7, Applied Biosystems) with the following program ...
-
bioRxiv - Cancer Biology 2021Quote: ... CellEvent™ Caspase-3/7 Green live staining detection reagent (Thermofisher Scientific) at 2 μM was prepared and added to the epithelial and vascular channels in order to visualize an apoptotic T-cell killing response ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 g anti-μ cadherin-11 (Thermo Fisher Scientific Cat#32-1700) or 4 μg anti-HA antibodies (Millipore Sigma Cat#H6908) ...
-
bioRxiv - Cancer Biology 2020Quote: ... for 7 minutes at 20 V using iBlot 2 (Thermo Fisher Scientific). Blots were blocked in 5% dried milk (AppliChem ...
-
bioRxiv - Cell Biology 2021Quote: ... and a QuantStudio 7 Real-Time PCR system (Thermo Fisher Scientific, USA) (52) ...
-
bioRxiv - Microbiology 2020Quote: ... 5 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific) were applied for monitoring effector caspase activation and 2.5 µM AlexaFluor647 hydrazide for detecting cell lysis.
-
bioRxiv - Neuroscience 2021Quote: ... or 10 μM 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA; Thermo Fisher Scientific #D399), an MRP family substrate ...
-
bioRxiv - Microbiology 2021Quote: ... with 7 ml per plate in the following medium: RPMI-1640 (Gibco), 2 mM L-glutamine (LifeTechnologies) ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... Coverslips were carefully transferred to glass slides (Fisher Scientific, #12-544-7) and fixated using AquaPolymount (Polysciences Inc. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Immunohistochemical staining was performed to confirm the presence of cytokeratin-7 (Thermofisher), pan-vimentin (DAKO) ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using ViiA 7 Real-Time PCR system (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... EPCR PE (Clone RMEPCR1560, SCT) and 7-Aminoactinomycin D (7AAD) (Life Technologies). The cells were sorted on an Influx (BD ...
-
bioRxiv - Cell Biology 2020Quote: ... COS-7 cells were grown on thin coverslips (Thermo Fisher Sci. 12541A) in 6 well plates ...
-
bioRxiv - Bioengineering 2022Quote: ... qPCR reaction was run in ViiA 7 Real-Time PCR System (ThermoFisher) with standard program ...