Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for Zika Virus NS1 Protein Uganda strain since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... coli BL21 (DE3) strain (Invitrogen), with and without the poRibo-T2 vector carrying the Ribo-T ribosomal DNA for the expression of Ribo-T ribosomes1 ...
-
bioRxiv - Microbiology 2020Quote: ... coli cloning strain DH5α (Invitrogen). I grew E ...
-
bioRxiv - Microbiology 2020Quote: ... coli (ccdB Survival strain, Invitrogen).
-
bioRxiv - Cancer Biology 2020Quote: ... Stbl3 strain (Invitrogen C7373-03) was transformed by the guides-containing plasmids ...
-
bioRxiv - Developmental Biology 2022Quote: ... coli strain BL21-AI (Invitrogen) was purified using Ni-NTA agarose resin (FUJIFILM) ...
-
bioRxiv - Biochemistry 2022Quote: ... cerevisiae strain INVSc1 (Thermo Fisher) using the S.c ...
-
bioRxiv - Biochemistry 2022Quote: ... coli strain BL21 (DE3) (Invitrogen). Liquid cultures were grown in lysogeny broth at 37°C and 220 rpm until an OD600 of 0.7 ...
-
bioRxiv - Biochemistry 2019Quote: ... coli BL21 (DE3) strain (Invitrogen). Transformed cells were grown to OD600 ~ 0.4 ...
-
bioRxiv - Microbiology 2019Quote: ... pastoris strain GS115 (Invitrogen™) via electroporation ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli strain DH10B (ThermoFisher Scientific). The transformed cells were then plated on 10 cm Lysogeny broth (LB)-agar Petri dishes supplemented with 400 μg/mL ampicillin (Sigma ...
-
bioRxiv - Microbiology 2019Quote: ... Escherichia coli strains Top10 (Invitrogen) were grown in Luria-Bertani broth or agar (both from Sigma Aldrich ...
-
bioRxiv - Biochemistry 2019Quote: ... coli BL21(DE3) strain (Invitrogen). Six MtrOtsA mutants (Arg213Glu ...
-
bioRxiv - Microbiology 2020Quote: ... pastoris strain KM71H (Invitrogen, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: Escherichia coli strain TOP10 (Invitrogen) was used for cloning purposes and cultivated in dYT [1% (w/v ...
-
bioRxiv - Immunology 2020Quote: ... pastoris strain X-33 (Invitrogen) by electroporation ...
-
bioRxiv - Microbiology 2020Quote: ... coli BL21(DE3) strain (Invitrogen). Bacteria were grown at 37°C to an OD600nm of 0,7 and induced with 1mM IPTG at 20°C for 20h ...
-
bioRxiv - Cell Biology 2022Quote: Escherichia coli strain TOP10 (Invitrogen) was used for all cloning purposes and amplification of plasmid DNA ...
-
bioRxiv - Plant Biology 2022Quote: ... Escherichia coli (strain INVαF, ThermoFisher) was used for cloning plasmid constructs and A ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli strain (Thermo Fisher Scientific) using chemically competent cells ...
-
bioRxiv - Microbiology 2022Quote: ... Escherichia coli strains Top10 (Invitrogen) and S17-1 λpir [113] were used as hosts for the cloning procedures.
-
bioRxiv - Microbiology 2023Quote: ... Escherichia coli strains Top10 (Invitrogen) and DH5α were used for cloning and were grown in Luria broth (LB ...
-
bioRxiv - Synthetic Biology 2023Quote: ... coli BL21 (DE3) strain (Invitrogen). Unless otherwise noted all E ...
-
bioRxiv - Neuroscience 2024Quote: ... coli BL21DE3 strain (Life technologies). Then ...
-
bioRxiv - Microbiology 2024Quote: Escherichia coli strain DH5a (Gibco) was used for propagation of plasmid DNA constructs and E ...
-
bioRxiv - Molecular Biology 2024Quote: ... coli strain TOP10 (Thermo Scientific). The plasmids were then purified and transfected into U343 cells depleted with PDCD4/eIF3F/eIF3G using siRNAs ...
-
Histone deacetylase inhibitors butyrate and bufexamac inhibit de novo HIV-1 infection in CD4 T-cellsbioRxiv - Microbiology 2020Quote: ... Pelleted virus was resolved in PBS (Gibco) and stored at −80°C until further usage ...
-
bioRxiv - Immunology 2019Quote: ... murine leukemia virus reverse transcriptase (RT; Invitrogen), and random hexamers (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2021Quote: ... Fibroblasts were reprogrammed using Sendai virus (Invitrogen) in feeder-free conditions on Matrigel (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... and EmGFP reporter Sendai Virus (A16519, Invitrogen) were part of the Cytotune -iPS 2.0 Sendai Reprogramming kit and EmGFP Sendai Fluorescence Reporter kit ...
-
bioRxiv - Immunology 2024Quote: ... in virus growth medium (1X MEM [Gibco 11095080] ...
-
bioRxiv - Molecular Biology 2022Quote: The parent strain used for engineering and protein production was Komagataella phaffii GS115 (Thermo Fisher Scientific, Waltham, MA, USA), which has a mutation in the his4 gene ...
-
bioRxiv - Microbiology 2024Quote: Recombinant soluble spike and RBD proteins from Wuhan-1 and BA.1 SARS-CoV-2 strains were expressed as described 58,59 Recombinant proteins were produced in Expi293F cells (ThermoFisher) by transfection of DNA using the ExpiFectamine 293 Transfection Kit (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... Equal amounts of the cell lysate protein and equal volume of the virus pellet protein were resolved by SDS-PAGE (NuPAGE 4-12% Bis-Tris gel; Invitrogen/Thermo Scientific) and transferred onto nitrocellulose membrane by semidry transfer ...
-
bioRxiv - Microbiology 2022Quote: ... The levels of RNA corresponding to the N protein-encoding gene of SARS-CoV-2 were measured using the TaqMan Fast Virus 1-step Master Mix (Thermo Scientific). Each 20-μL reaction mixture contained 5.0 μL of 4× TaqMan Fast Virus 1-Step Master Mix ...
-
bioRxiv - Microbiology 2019Quote: ... The viral N-protein was labeled using a primary anti-Tula virus antibody(12) and a secondary anti-rabbit FITC conjugate (Invitrogen, USA). The viral Gc protein was stained using a mouse monoclonal antibody (#H1808-60B ...
-
bioRxiv - Bioengineering 2023Quote: ... The levels of RNA corresponding to the N protein-encoding gene of SARS-CoV-2 were measured using the TaqMan Fast Virus 1-step Master Mix (Thermo Scientific). Each 20-μL reaction mixture contained 5.0 μL of 4× TaqMan Fast Virus 1-Step Master Mix ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1μl of sample was mixed in 20μl final of SoFast-Green reaction mix containing 10nM of forward (CCGTCTTAAGTTTGATTTT) and reverse (AGAGGTGGACCAACTCGGTA) primers for MVMp NS1 gene amplification using the StepOnePlus real-time PCR system (Thermo Fisher Scientific). Primers targeting the 18S gene were used for normalization (forward ...
-
bioRxiv - Systems Biology 2020Quote: ... the different Sla1 engineered proteins were constructed using the BY4741 Sla1-GFP strain from the GFP collection (Thermo Fisher Scientific) (43 ...
-
bioRxiv - Microbiology 2020Quote: ... 100μg of whole cell lysate from each strain was run on NuPage 4-12% bis-tris protein gel (Thermo Scientific) at 120V for 3hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... For Protein A-tagged strains, immunoprecipitation was carried out with Rabbit IgG-conjugated (MP-Biomedicals, SKU 085594) Dynabeads (Invitrogen, 14301) as described 57 ...
-
bioRxiv - Genetics 2019Quote: ... 10 pairs of testes from each transgenic strain were pooled to constitute a biological replicate for total RNA and protein extraction using TRI reagent (Ambion). RNA was reverse-transcribed using Superscript II (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... were coated with 100 µL of recombinant SARS-CoV-2 S protein (Wuhan-1 strain and BA.5) at a concentration of 1 µg/mL in PBS (Gibco) at 4°C overnight ...
-
bioRxiv - Microbiology 2021Quote: ... Equal amounts of the cell lysate protein and equal volume of the virus pellet protein were resolved by SDS-PAGE (NuPAGE 4-12% Bis-Tris gel; Invitrogen/Thermo Scientific) and transferred onto nitrocellulose membrane by semidry transfer ...
-
bioRxiv - Genetics 2019Quote: Parental strains used to generate the recombination map were the laboratory strain GS115 (Thermo Fisher Scientific) and the natural isolate Pp4 (NRRL YB-378) ...
-
bioRxiv - Microbiology 2020Quote: ... or P1 SARS-CoV-2/München- 1.1/2020/929 (Munich) virus was diluted to 500 µl in 15 ml with virus dilution medium (Opti-MEM, Gibco) supplemented with 2% (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... Next day cells were washed with phosphate-buffered saline (PBS) and infected with virus in Virus Production Serum Free Media (VPSFM; Gibco) supplemented with 0.25-0.5 ug/mL TPCK-Trypsin ...
-
bioRxiv - Immunology 2019Quote: ... and Moloney Murine Leukemia Virus reverse transcriptase (Invitrogen). Amplification of cDNAs was performed by quantitative real-time PCR reactions on a Light Cycler instrument (LC480 ...
-
bioRxiv - Microbiology 2020Quote: ... Virus was diluted in infection media (DMEM (Invitrogen) supplemented with 35% BSA (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... using Sendai virus-mediated transduction (Thermofisher Scientific, #A16517) or nucleofection (Amaxa ...
-
bioRxiv - Microbiology 2020Quote: ... and 50% virus solution in RPMI media (Gibco). Mosquitoes were left to feed for 1.5 h using Hemotek membrane feeder system (Discovery Workshops ...