Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for Mouse NXPE4 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... 1.5 μg each of plasmid were transiently transfected into E14tg2A mouse stem cells using Lipofectamine 2000 (ThermoFisher) in suspension according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Stable transfections of NIH – vGPCR for different shRNAs were performed using the Lipofectamine Plus Reagent (Invitrogen). NIH-vGPCR cells were plated at 60% confluence in 10 cm plates and transfected with 2ug of shRNA (shScramble and shRNAs targeted against Nrf2 - GIPZ Nfe2l2 shRNA Thermo RMM4532-EG18024) ...
-
bioRxiv - Biochemistry 2021Quote: ... adenoviruses expressing LacZ and Tpi shRNA were cloned into the Adenoviral Gateway Expression System (Invitrogen, CA). In brief ...
-
bioRxiv - Genomics 2021Quote: ... The WTC11 iPSCs transduced with shRNA lentivirus were treated with hygromycin (Gibco, 10687010, 150 µg/mL) for 7 days and then collected for RNA extraction and qPCR.
-
bioRxiv - Evolutionary Biology 2022Quote: ... and shRNA for TP53 into 300,000 fibroblasts from each individual with a Neon Electroporation Device (Invitrogen), using a 100 μL kit ...
-
bioRxiv - Cell Biology 2023Quote: ... Stable clones expressing the specific shRNAs were selected using 5μg/ml of puromycin (Gibco-life technologies) and pooled to generate the cells used in the experiments.
-
bioRxiv - Cell Biology 2023Quote: ... Selection of stably shRNA-expressing polyclonal cell lines was achieved using puromycin (1 µg/mL; Gibco). pLKO.1 with non-targeting sequence 5’-AATTGCCAGCTGGTTCCATCA-3’ was used to generate shRNA control (shCON ...
-
bioRxiv - Molecular Biology 2022Quote: ... Mouse ES cells were transfected with 1 μg of plasmid containing Cas9 and gRNAs using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... gRNAs and Cas9 plasmids were co-transfected into 293T or mouse R1 ESC cells with LipofectamineTM (Invitrogen, L3000015) or PolyJetTM (SL100688 ...
-
bioRxiv - Cancer Biology 2019Quote: ... TCF4 shRNA lentiviral supernatant was generated with ViraPower Lentiviral Packaging Mix (Thermo Fisher Scientific, Waltham, MA, USA) and used to infect LNCaP cells ...
-
bioRxiv - Molecular Biology 2022Quote: Lentiviral packaging of shRNA constructs was conducted in 293T/17 cells using Lipofectamine 2000 (Thermo Fisher Scientific). In brief ...
-
bioRxiv - Molecular Biology 2020Quote: Bovine Creb5 shRNAs targeting the Creb5 3’UTR were designed using Block-iT RNAi designer (Thermo Fisher). The most efficient Creb5 shRNA sequence we identified was ...
-
bioRxiv - Molecular Biology 2024Quote: ... Recombinant adenoviruses expressing the GRK2 shRNA were produced using BLOCK-iT™ Adenoviral RNAi Expression System (Invitrogen) according to the manufacturer’s instruction.
-
bioRxiv - Developmental Biology 2023Quote: Total RNA from NT and shRNA transduced EBs was extracted using TRIzol RNA isolation reagents (ThermoFisher Scientific). cDNA was synthesized using iScript cDNA Synthesis Kit from Bio-Rad ...
-
bioRxiv - Cancer Biology 2023Quote: Functional shRNA was cloned into piggybac transposon inducible expression vector PB_tet-on_Apple_shGFP using HindIII and Kpn2L (ThermoFisher)25 ...
-
bioRxiv - Neuroscience 2023Quote: ... Complementary DNA oligomers for the scramble shRNA sequences with ends overlapping with the receiving vector (Thermofisher Scientific) were annealed to generate double stranded oligomers ...
-
bioRxiv - Developmental Biology 2021Quote: Mouse C2C12 cells (ATCC CRL-1772) were transfected with plasmid pGL4.26 BRE2 using Lipofectamine 3000 (Thermo Fisher Scientific, L300015) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were transfected with the recombinant pcDNA3.1 plasmid (6 μg/flask) containing mouse Wnt10b cDNA using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: Total RNA from shRNA transduced C2C12 cells was extracted using RNAqueous®-Micro Total RNA Isolation Kit (ThermoFisher). 1 μg total RNA was used to generate one strand cDNA using the qScript™ cDNA Synthesis Kit (Quanta Biosciences) ...
-
bioRxiv - Microbiology 2019Quote: ... HeLa-CD4-shRNA-REAF were selected for resistance to puromycin in media supplemented with 10μg/ml puromycin (Invitrogen).
-
bioRxiv - Cancer Biology 2021Quote: ... MDA-MB-231 F2 cells were then infected with shRNA packaged within lentiviruses in Opti-MEM (Invitrogen 51985034) supplemented with 8µg/mL polybrene (Millipore TR-1003-G) ...
-
Myosin VI regulates ciliogenesis by promoting the turnover of the centrosomal/satellite protein OFD1bioRxiv - Cell Biology 2021Quote: ... pSLIK-NEO myosin VI shRNA was generated with Gateway™ LR Clonase™ II Enzyme mix (ThermoFisher Scientific) by subcloning a nucleotide sequence targeting myosin VI (5’- AGTAATTCAGCACAATATTCCAA - 3’ ...
-
bioRxiv - Microbiology 2022Quote: ... shRNAs targeting BUD23 or overexpressing ORF11-FLAG were seeded in triplicate in 12-well culture plates (Thermo Fisher) at a density of 3 × 105 cells per well and grown for 24 hours ...
-
bioRxiv - Neuroscience 2023Quote: ... the short hairpin RNA (shRNA) for Nrg1 was designed using online BLOCK-iT™ RNAi Designer program (Invitrogen) and the shRNA sequences targeting neuregulin were ...
-
bioRxiv - Neuroscience 2023Quote: ... The ssDNA primers to generate the shRNAs were obtained using the Block-it RNAi web tool (Thermo Scientific) and were as follows ...
-
bioRxiv - Neuroscience 2021Quote: ... Plasmids were purified with HiPure Plasmid Maxiprep kits (Invitrogen).
-
bioRxiv - Cell Biology 2022Quote: Purified plasmids (GeneJET Plasmid Miniprep Kit, Thermo Scientific K0503) were microinjected into embryos of nos/attP40 flies for mVenus fusion gene construct injection and nos-Cas9 flies for CRISPR mutagenesis ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were isolated using GeneJet Plasmid Miniprep Kit (ThermoFisher).
-
bioRxiv - Cell Biology 2022Quote: ... Both the LentiCRISPRv2-sgRNA plasmid and the ss donor oligonucleotides were transfected into D3 mouse ESC line using Lipofectamine 3000 (Invitrogen). Transfected cells were selected with puromycin (1.5 μg/ml ...
-
bioRxiv - Biochemistry 2021Quote: ... Both the LentiCRISPRv2-sgRNA plasmid and the ss donor oligonucleotides were transfected into D3 mouse ES cell line using lipofectamine 3000 (Invitrogen). Transfected cells were selected with puromycin (1.5 μg/ml ...
-
bioRxiv - Cell Biology 2024Quote: ... we transfected Sox2se-CPG-TV-dTomato and Cdk1-Snrpn-dTomato plasmids into mouse iPSCs using Lipofectamine 2000 Transfection Reagent (Invitrogen) according to the provider’s protocol ...
-
bioRxiv - Plant Biology 2019Quote: ... in frame with a downstream GFP reporter gene in the pB7FWG,0 plasmid, or in the pB7WG plasmid respectively (Ghent plasmids collection, http://bccm.belspo.be/index.php) via Gateway technology (Invitrogen). As the S2Lb fragment was cloned without STOP codon ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells with stable integration of the shRNA construct were determined by a selection of puromycin-resistant colonies (0.5 μg/ml puromycin; Invitrogen). The efficacy of TRMT2A silencing effect was determined by qPCR and Western blot ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 µg PAX2 and 4 µg shRNA in pLKO.1 backbone using Lipofectamine 3000 (Thermo Fisher Scientific, Waltham, MA) according to the manufacturer’s instructions ...
-
The pan-cancer lncRNA PLANE regulates an alternative splicing program to promote cancer pathogenesisbioRxiv - Cancer Biology 2020Quote: ... and the annealed shRNA oligos were inserted into the digested vector using the T4 DNA ligase (ThermoFisher Scientific, #EL0014). The lentiviral particles were packaged via co-transfection of FH1-tUTG vector inserted with shRNA oligos (44 μg) ...
-
bioRxiv - Cell Biology 2022Quote: ... The shRNA target sequence was designed for protein knockdown using the BLOCK-iT RNAi Designer tool (Thermo Fisher Scientific). A cassette containing the pre-shRNA sequence was inserted into pBAsi-mU6 (Takara Bio) ...
-
bioRxiv - Molecular Biology 2022Quote: ... shRNA sequences targeting the murine Uhmk1 gene were designed using the BLOCK-IT™ RNAi Designer tool (Invitrogen™), cloned into the MSCV-U3-H1-Stuffer entry vector digested with BglII and HindIII and subcloned into the retroviral vector pMSCV-puromycin-IRES-EGFP siRNA digested with the NotI and ScaI [55] ...
-
bioRxiv - Neuroscience 2024Quote: ... The ssDNA primers to generate the shRNAs were either obtained using the Block-it RNAi web tool (Thermo Scientific) or designed by hand and were as follows:
-
bioRxiv - Cell Biology 2023Quote: Two sets of USP3 shRNAs were designed against its target sequence and cloned independently into pSilencer2.1-U6 hygro vector (Ambion). Scrambled shRNA with limited homology to any known sequences was cloned into the same vector and could serve as the negative control ...
-
bioRxiv - Genetics 2023Quote: ... RKO and HT-1080 shRNA+ cells from the competition proliferative assay experiment were selected with Geneticin/G418 Sulfate (Gibco) for 7 days and checked for GFP expression ...
-
bioRxiv - Immunology 2023Quote: ... lentiviruses for individual shRNAs were produced in HEK293T cells plated in six-well plates in antibiotic-free DMEM (Gibco, supplemented with glutamine and 10 %FBS) ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids were extracted using GeneJET plasmid miniprep kit (Thermo Fisher) per manufacturer protocols ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmids were isolated using PureLink Quick Plasmid Miniprep Kit (Invitrogen) and Sanger sequenced with the universal primers M13Forward and M13Reverse.
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmids were isolated using PureLink Quick Plasmid Miniprep Kit (Invitrogen) and quantified by spectrophotometric analysis (Biophotometer ...
-
bioRxiv - Microbiology 2021Quote: ... Plasmid was purified using Purelink-Midi plasmid purification kit (Invitrogen). Plasmid transfection was done using Fugene HD (Promega) ...
-
bioRxiv - Microbiology 2022Quote: ... plasmids extracted using a GeneJet Plasmid Purification Kit (Thermo Scientific), and constructs sequence-verified using Sanger sequencing (Genewiz).
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmids were isolated (GeneJET Plasmid Miniprep kit, Thermo Fisher Scientific) and confirmed by restriction enzyme digestion and/or Sanger sequencing (Eurofins ...
-
bioRxiv - Plant Biology 2023Quote: ... The plasmids were extracted using Plasmid DNA Miniprep Kit (ThermoFisher), and the sequences were confirmed by sequencing of the ligation sites (Macrogen) ...
-
bioRxiv - Microbiology 2023Quote: ... followed by plasmid isolation (GeneJET Plasmid Miniprep System; Thermo Fisher). Isolated plasmids were test digested and sequenced.
-
bioRxiv - Molecular Biology 2024Quote: ... Plasmids were purified using GeneJET Plasmid Miniprep Kit (ThermoFisher, K0502) and GeneJET (ThermoFisher ...