Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for Human SKI Like Oncogene SKIL CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... Luminex assay was performed using ProcartaPlex Human Basic Kit (Invitrogen) and a panel of ProcartaPlex Human Simplex (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: The IL-6 Receptor (Soluble) Human ELISA Kit (Invitrogen; BMS214) was used to quantify soluble IL-6Ra expression in cell culture media ...
-
bioRxiv - Immunology 2023Quote: Total human IgG levels were determined following the manufacturer’s instructions in the Human IgG Total ELISA Kit (Invitrogen).
-
bioRxiv - Bioengineering 2021Quote: Our RGD-containing elastin-like proteins (ELP) are expressed in BL21 (DE3) pLysS Escherichia coli (Invitrogen, 1931008) under control of the T7 promoter ...
-
bioRxiv - Plant Biology 2021Quote: The Trx-like domain and CTD were separately dialyzed in a 10 kDa dialysis card (Thermo Fisher) with the Buffer (25 mM Hepes pH 7.5 ...
-
bioRxiv - Neuroscience 2021Quote: ... NSC34 motoneuron-like mouse hybrid cell line (available in house) was cultured in DMEM (Thermo Fisher Scientific) with 5%FBS (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2021Quote: ... fibroblast outgrowths were dissociated and split 1:4 using a recombinant trypsin-like enzyme (TrypLE Select, Invitrogen). Additional fibroblast preparations were commercially available ...
-
bioRxiv - Neuroscience 2022Quote: Long-term media for cortical-like neurons and sensory neurons consisted of Neurobasal (475mL, Life Technologies 21103049), B27 supplement (10mL ...
-
bioRxiv - Microbiology 2022Quote: ... microglia-like cells with intracellular cryptococci were washed with Hank’s Balanced Salt Solution (pH 7.2; Thermo Fisher), and the slides were stained with 0.01% acridine orange (Sigma ...
-
bioRxiv - Cell Biology 2022Quote: ... Human AFP secreted into the sera of animals were determined by the Human AFP Elisa Quantification Kit (Invitrogen, EHAFP) following manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... corresponding to the concentration of the highest standard of recombinant human IFNγ (Human IFNγ Gamma Uncoated ELISA kit, Invitrogen). IFNγ concentrations below the level of detection by the ELISA standard curve were set to 0 pg/ml ...
-
bioRxiv - Genetics 2021Quote: ... We quantified expression using the IgG4 Human ELISA kit (Invitrogen BMS2095) with IgG4 standards provided in the kit ...
-
bioRxiv - Immunology 2022Quote: Murine TNF-α and IL-1β were quantified in cell supernatants using ELISA™ Kit from Invitrogen and human IL-1β using Instant ELISA™ Kit from Invitrogen, following manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2020Quote: ... An IgG4 Human ELISA Kit (Cat # BMS2095, Thermo Fisher, Waltham, MA) was purchased to verify the antibody secretion titer according to the manufacturers instructions.
-
bioRxiv - Cell Biology 2019Quote: ... Analysis was done using the human 63-plex kit (eBiosciences/Affymetrix). Beads were added to a 96 well plate and washed in a Biotek ELx405 washer ...
-
bioRxiv - Immunology 2021Quote: Elastase was measured using the Human PMN-Elastase ELISA Kit (Invitrogen) in neutrophil culture supernatant at 6 hours after stimulation ...
-
bioRxiv - Immunology 2021Quote: Human TNF alpha Uncoated ELISA Kit (ThermoFisher, catalog no. 88-7346) was used to determine secretion of TNF-α in culture supernatants of cells treated with SARS-CoV-2 S1 subunit ...
-
bioRxiv - Immunology 2020Quote: ... assays were run using the Complement C5a Human ELISA Kit (Invitrogen). For sample preparation ...
-
bioRxiv - Immunology 2023Quote: ... using the Dynabeads Untouched Human CD4 T cell kits (Thermofisher, USA). T lymphoblast were generated by culturing T cells at 2 million/mL onto P12 wells on RPMI 1640 with FBS (10 %) ...
-
bioRxiv - Immunology 2023Quote: ... and erythrocytes using the Dynabeads Untouched Human Monocytes Kit (Invitrogen, 11350D) (Supplemental Figure 2).
-
bioRxiv - Molecular Biology 2024Quote: ... total RNAs were processed with RiboMinus kit (Human/ Mouse Module, Invitrogen) to deplete most ribosomal RNAs (ribo-RNA) ...
-
bioRxiv - Immunology 2024Quote: ... and ELISA analysis (human IL-1β ELISA Kit, Thermo Fisher Scientific) according to the manufacturer ‘s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... Secondary antibodies like goat anti-mouse IgG/IgM Alexa flour 488/543 (A11029; Thermo Fisher Scinetific; 1:2000), goat anti-Rabbit Alexa Flour 546 (A11003 ...
-
bioRxiv - Neuroscience 2020Quote: ... IA) with the top ranking promoter-like elements altered by synonymous mutations and cloned into pCR4-Blunt (Invitrogen). Bacterial clones were screened by restriction digestion and those with correct patterns were analyzed by DNA sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... For nuclei staining HL-60 neutrophil-like cells were treated with 0.5□μg/ml Hoechst 33342 (Life Technologies) for 5□minutes at 37□°C and washed in PBS once ...
-
bioRxiv - Cell Biology 2020Quote: 7000 Monkey kidney fibroblast-like COS-7cells were seeded per well in gelatin-coated 96- well plates (Gibco DMEM ...
-
bioRxiv - Microbiology 2021Quote: J774.1 mouse macrophage-like cells (ECACC, Salisbury, UK) were cultured in Dulbecco’s Modified Eagle Medium (DMEM, Thermo Fisher) supplemented with 200 U/ml penicillin/streptomycin ...
-
bioRxiv - Immunology 2023Quote: Human embryonic kidney (HEK) epithelial-like cell line HEK293T was maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) (11965-118; GIBCO™ ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The T cells were isolated using the EasySep human T cell isolation kit (Stemcell) and activated with human T-activator CD3/CD28 Dynabeads (Gibco) at a bead:cell ratio of 1:1 ...
-
bioRxiv - Microbiology 2020Quote: ... Enzyme-linked immunosorbent assays (ELISAs) for human IL-8 were performed using the Human IL-8 ELISA Kit (ThermoFisher SCIENTIFIC) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... human PBMC derived T cells were purified by Human T cell isolation kit from Invitrogen (Invitrogen Dynal AS, Oslo, Norway) according to manufacturer’s instruction ...
-
bioRxiv - Immunology 2021Quote: ... and total T cells were purified from PBMC suspensions by negative immunomagnetic selection (purity >90%) using the Human Myeloid DC Enrichment Kit (STEMCELL) and the Untouched total human T cell (Invitrogen) kits ...
-
bioRxiv - Neuroscience 2023Quote: ... A HeLa cell lysate-based Kit (1-Step Human Coupled IVT Kit—DNA, 88881, Life Technologies) enabled in vitro translation of these constructs ...
-
bioRxiv - Immunology 2021Quote: ... the concentrations of human IL-2 and IFN-γ were measured using a IL-2 Human Uncoated ELISA Kit (Thermo Fisher) and IFN-γ Human Uncoated ELISA Kit (Invitrogen) ...
-
bioRxiv - Immunology 2021Quote: Human interleukin two (IL-2) Ready-SET Go! ELISA kit (eBioscience/Invitrogen) and Nunc MaxiSorp 96-well plates (Thermo Fisher ...
-
bioRxiv - Genetics 2020Quote: ... and quantified using the Quantifiler Human DNA Quantification kit (Thermo Fisher Scientific) on an Applied Biosystems 7500 Real-time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... B-lymphocytes were enriched using Dynabeads Untouched Human B Cells Kit (Invitrogen). Each sample was loaded into two lanes (i.e ...
-
bioRxiv - Neuroscience 2022Quote: ... Aβ42 concentrations were measured using the Human Aβ42 ELISA kit (Thermo Fisher) according to the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2022Quote: ... was measured with AmpliSeqTM (Whole transcriptome Human Gene Expression Kit, Life Technologies) for 28 donor AMs at 2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... using Human IFN gamma Uncoated ELISA Kit (Life Technologies 88-7316-22) and Human Granzyme B DuoSet ELISA (R&D DY2906-05) ...
-
bioRxiv - Neuroscience 2021Quote: Aβ42 levels were measured using a human Aβ42 ELISA kit (Thermo Scientific) following manufacturer instructions ...
-
bioRxiv - Microbiology 2022Quote: ... We determined sIgA concentrations by ELISA (Human IgA ELISA kit; Thermo Fisher), replacing the provided monomeric IgA standards with sIgA ELISA standards (Abnova) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... on plates coated with recombinant human collagen I (Coating Matrix kit, Gibco) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Leptin levels were determined using Human Leptin Instant ELISA kit (Invitrogen BMS2039INST) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2023Quote: ... Human Aβ40 and Aβ42 levels were measured using commercial kits (Invitrogen, MA). Assay values were normalized to total protein.
-
bioRxiv - Immunology 2024Quote: ... and human Treg expansion kit anti-CD3/CD28 beads (Miltenyi Biotec/Invitrogen), using x-vivo 15 cell medium (Lonza ...
-
bioRxiv - Cell Biology 2022Quote: ... ES03 cells were grown on MEF feeders in KSR+bFGF and passaged enzymatically using trypsin-like enzyme (TrypLE, Invitrogen) for at least 3 passages before electroporation ...
-
bioRxiv - Microbiology 2019Quote: ... The MamK-like gene from strain Poly30T was amplified by standard PCR procedures with Phusion DNA polymerase (Thermo Scientific) using the primers RPA821_NheI (CTAGCTAGCATGACCGACATC ACGACCGAC ...
-
bioRxiv - Microbiology 2021Quote: Green monkey kidney fibroblast-like Cos7 cells were cultured at 37 °C with 5% atmospheric CO2 in Dulbecco’s Modified Eagle Medium (DMEM; Gibco, Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... BMEC-like cells in well plates were treated with 10 μM cyclosporin A (CsA; Fisher Scientific #11-011-00), a p-glycoprotein inhibitor ...