Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for 6 2 Ethoxyphenyl 6 oxohexanoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2024Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI) (Life Technologies), using Alexa Fluor 594 anti-insulin (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Invitrogen)
-
bioRxiv - Physiology 2024Quote: ... DAPI (4′, 6-diamidino-2-phenylindole, Thermo Fisher, 62248), Hoescht 33342 (Thermo Fisher ...
-
bioRxiv - Physiology 2024Quote: ... 6-Diamidino-2-Phenylindole (DAPI; Thermo Fisher Scientific, D1306). Staining was observed under a Nikon eclipse 80i light microscope or a Nikon eclipse Ti2 confocal microscope ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:10000, Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher, 62248); Acetic acid (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2024Quote: ... DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) (ThermoFisher, D1306) was used at a 1:300 dilution ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen D1306) for 1h at room temperature in the dark ...
-
bioRxiv - Developmental Biology 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Immunology 2021Quote: ... mouse interleukin 6 (IL-6; ThermoFisher; 1:500). Sections were then stained for DAPI (Sigma ...
-
bioRxiv - Neuroscience 2023Quote: ... and passaged every 4-6 days with 0.5mM ethylenediaminetetraacetic acid (EDTA, Invitrogen 15575020) in Dulbecco’s Phosphate-Buffered Saline (DPBS ...
-
bioRxiv - Bioengineering 2024Quote: ... Palmitic acid (Palm) and 5(6)- carboxyfluorescein (FAM) were acquired from Acros Organics. Piperidine ...
-
bioRxiv - Cell Biology 2020Quote: ... 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) was utilized to detect the nuclei ...
-
bioRxiv - Microbiology 2021Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific).
-
bioRxiv - Genomics 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Life Technologies) was added to visualize cell nuclei ...
-
bioRxiv - Neuroscience 2020Quote: ... DAPI (4’,6-diamidino-2-phenylindole dihydrochloride, ThermoFisher Scientific, D1306) was applied to nuclei samples at a concentration of 0.1µg/ml ...
-
bioRxiv - Bioengineering 2020Quote: ... incubated with 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher), rinsed with TBS ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by 6 column volumes of elution buffer (2× GIBCO 14200-075 PBS ...
-
bioRxiv - Biophysics 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed for actin cytoskeleton and nucleus staining ...
-
DNA uptake by cell wall-deficient bacteria reveals a putative ancient macromolecule uptake mechanismbioRxiv - Microbiology 2022Quote: ... 10 mM Laurdan (6-Dodecanoyl-2-Dimethylaminonapthalene) stock solution (Invitrogen) was prepared in 100% dimethylformamide (DMF ...
-
bioRxiv - Cancer Biology 2020Quote: ... SSC and DAPI (4’,6-diamino-2-phenylindole) (Fisher Scientific) staining profiles ...
-
bioRxiv - Physiology 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) was used (Invitrogen; 1:5000).
-
bioRxiv - Physiology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Molecular Biology 2020Quote: ... pH 6 using a 2 kDa MWCO dialysis unit (ThermoFisher). Heats of binding were measured using a MicroCal iTC200 calorimeter (GE Healthcare ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... containing 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, Cat # P36935), and analyzed by LSM510 Meta Laser or Leica TCS SPE confocal microscopes (× 63 glycerol immersion objectives ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 - diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Cell Biology 2021Quote: ... and 4′,6-diamidino-2-phenylendole (DAPI; 1:5000, Invitrogen) or Hoechst (1:10,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The staining was visualized using a microscope (Zeiss ...
-
bioRxiv - Cancer Biology 2022Quote: ... DAPI (4′,6-Diamidino-2-Phenylindole; Thermo Fisher Scientific, D1306),
-
bioRxiv - Biophysics 2022Quote: ... and 6-Dodecanoyl-2-Dimethylaminonaphthalene (Laurdan) were purchased from ThermoFisher Scientific Ltd ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) for nuclear detection (ThermoFisher MA). For live-cell imaging ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, Invitrogen Cat. D1306), was added ...
-
bioRxiv - Microbiology 2023Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Scientific) and LACV antibody as described below ...
-
bioRxiv - Cell Biology 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride, 1:10,000, Invitrogen) was used as a DNA counterstain together with the secondary antibody ...
-
bioRxiv - Microbiology 2024Quote: ... 6’-diamidino-2 phenylindole (DAPI; Cat. P36941, Invitrogen, Carlsbad, CA) and visualized on a Leica Stellaris confocal microscope using a 63x oil immersion objective ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher D1306) and stored in the dark at 4°C until imaging.
-
bioRxiv - Neuroscience 2023Quote: ... with 4′,6-diamidino-2-phenylindole (DAPI; ThermoFisher, 1:5000) were applied in blocking solution for 1h at RT on an orbital shaker ...
-
bioRxiv - Cancer Biology 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole) was from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific, Waltham, MA) was used to label nuclei ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) was utilized to detect the nuclei ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific - D1306) was used 1:10000 ...
-
bioRxiv - Microbiology 2023Quote: ... Counterstaining was with 4’-6-diamidino-2-phenylindole (DAPI) (Invitrogen) at 20 µg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... DAPI (4’,6-Diamidin-2-phenylindol, Dihydrochloride; Thermo Fisher Scientific) staining was performed prior to recording ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:10000, Thermo Fisher Scientific). Semi-quantitative methods were utilized for analysis ...
-
bioRxiv - Neuroscience 2024Quote: ... incubated with DAPI (40, 6-diamidino-2-phenylindole, Invitrogen, D1306) (0.5mg/ml in PBS ...
-
bioRxiv - Microbiology 2024Quote: ... and stained with DAPI (4′,6-diamidino-2-phenylindole) (Invitrogen). This process ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4′,6-diamidino-2-phenylendole (DAPI; 1:5000, Invitrogen) or Hoechst (1:10,000 ...