Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for 1R 2S 6R 7S 4 4 DIMETHYL 3 5 DIOXA 8 AZATRICYCLO 5.2.1.0 2 6 DECAN 9 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Counterstaining was with 4’-6-diamidino-2-phenylindole (DAPI) (Invitrogen) at 20 µg/mL ...
-
bioRxiv - Biochemistry 2023Quote: ... DAPI (4’,6-Diamidin-2-phenylindol, Dihydrochloride; Thermo Fisher Scientific) staining was performed prior to recording ...
-
bioRxiv - Microbiology 2024Quote: ... and stained with DAPI (4′,6-diamidino-2-phenylindole) (Invitrogen). This process ...
-
bioRxiv - Cell Biology 2024Quote: ... and 4′,6-diamidino-2-phenylendole (DAPI; 1:5000, Invitrogen) or Hoechst (1:10,000 ...
-
bioRxiv - Genetics 2024Quote: ... and DAPI (4′,6-diamidino-2-phenylindole) (Thermo Fisher Scientific). For Figure 5A and C and Figure 6 ...
-
bioRxiv - Genetics 2024Quote: ... and DAPI (4′,6-diamidino-2-phenylindole) (Thermo Fisher Scientific). For Figure S7 ...
-
bioRxiv - Microbiology 2024Quote: ... and 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI) solution (Invitrogen) for 1 h at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... 4′-6-diamidino-2-phenylindole (Life Technologies, 1:500 dilution) and HCS Cell Mask Deep Orange (Life Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific, UK) and Phalloidin-555 or 647 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were DAPI (4′, 6-diamidino-2-phenylindole; Thermo Fisher) stained and mounted on microscopy slides using Prolong Diamond antifade Mountant (Thermo Fisher) ...
-
bioRxiv - Cancer Biology 2024Quote: ... added with DAPI (4′,6-diamidino-2-phenylindole, Life Technologies, Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were next stained with 4’,6-diamidino-2-phenylindole (DAPI) (4 μg/mL) (Thermo Scientific) and analyzed using the BD LSRFortessa cell analyzer (BD Biosciences ...
-
bioRxiv - Cell Biology 2021Quote: ... For live imaging of cells as described for fatty acids up-take we treated cells at day 5 of differentiation with BODIPY™ (10μM) C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen). In addition ...
-
bioRxiv - Neuroscience 2024Quote: ... Nuclei were stained for 5 minutes with 1 µM 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen), coverslips were mounted on glass slides with mounting medium (Dako) ...
-
bioRxiv - Genomics 2023Quote: ... All nuclei were pooled and stained with DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306). Using a FACSAria III cell sorter (BD Biosciences) ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were marked with 2,3x10-3 µg/µL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 min at RT in the dark ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Cancer Biology 2021Quote: ... The synthesized cDNA was amplified by EBNA 3C (1F and 1R) primers (5’-GAGAAGGGGAGC GTGTGTTGT-3’, 5’-GCTCGTTTTTGACGTCGGC-3’) by using regular PCR and adding Taq DNA polymerase (ThermoFisher, USA). The components of 25 μL reaction mixture contained 10 μL extracted DNA ...
-
bioRxiv - Cell Biology 2020Quote: ... and 2 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific, 11916621) for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... adding 2 μg/mL DAPI (4’,6-diamidino-2-phenylindole; Thermo Fisher Scientific) and 1 μM QUMA-1 23 to the final wash ...
-
bioRxiv - Molecular Biology 2022Quote: ... siM1-4: 5’ -ACTGGTAGCTTATTAAAGATT- 3’) and the HOXA1 siRNA (5’ - AGAACTTCAGTGCGCCTTATT- 3’) were purchased from Invitrogen™ (Silencer® Select siRNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biophysics 2021Quote: ... Nucleus were stained with DAPI (4’, 6-diamidino-2-phenylindole, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was stained with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen). After washing with PBS ...
-
bioRxiv - Bioengineering 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (D1306; Life Technologies, Carlsbad, CA) and Alexa Fluor™ 568 Phalloidin (phalloidin ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, Life Technologies) was used to stain nuclei.
-
bioRxiv - Molecular Biology 2022Quote: ... and nuclei stained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen). Mowiol was used as mounting medium.
-
bioRxiv - Immunology 2022Quote: ... with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen™, Thermo Fisher) on microscope slides ...
-
bioRxiv - Immunology 2022Quote: ... with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen™, Thermo Fisher) on microscope slides ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 0.1% stock diluted 1/500 in PBS for use ...
-
bioRxiv - Cancer Biology 2022Quote: ... nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 0.1% stock diluted 1/500 in PBS for use ...
-
bioRxiv - Neuroscience 2021Quote: ... The fluorescent stain 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, P36931) and GFP were used to detect nuclei and α-syn accumulations ...
-
bioRxiv - Neuroscience 2020Quote: ... Larvae were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (ThermoFisher) for 30 minutes.
-
bioRxiv - Neuroscience 2022Quote: ... with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific D1306). Sections were imaged with a slide scanning confocal microscope.
-
bioRxiv - Immunology 2020Quote: ... DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific, CA, USA) was used to stain cell nuclei ...
-
bioRxiv - Pathology 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies, 1:250) to reveal actin and the nucleus ...
-
bioRxiv - Physiology 2020Quote: ... and subsequently 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:50000) for 20 minutes ...
-
bioRxiv - Systems Biology 2021Quote: ... and counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and 4’,6-diamidino-2-phenylindole counterstain (DAPI, Thermo Fisher Scientific) in antibody buffer at room temperature for one hour ...
-
bioRxiv - Microbiology 2022Quote: ... and mounted with ProLong Diamond + 4’,6-diamidino-2-phenylindole (Invitrogen). Imaging was performed on a Zeiss 880 laser scanning confocal microscope ...
-
bioRxiv - Microbiology 2024Quote: ... 4’,6’-diamino-2-fenil-indol (DAPI) (1:25000, Life Technologies) and Phalloidin (Alexa 488 ...
-
bioRxiv - Neuroscience 2024Quote: ... counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) or propidium iodide (PI ...
-
bioRxiv - Bioengineering 2023Quote: ... The 4′,6-diamidino-2-phenylindole (DAPI) was acquired from Invitrogen, Thermofisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:50000 dilution, Molecular Probes) was treated in the cells for 3min ...
-
bioRxiv - Bioengineering 2023Quote: ... together with 4′,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) diluted in 2% BSA in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, #D1306, 1/1000) were incubated overnight at 4°C in the dark ...