Labshake search
Citations for Thermo Fisher :
1401 - 1450 of 7095 citations for Recombinant Human MME Fc Chimera since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Cot-1 DNA (Invitrogen), 3M NaAc and 100% cold EtOH ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2021Quote: ... IL-2 Human Uncoated ELISA kit and IFNγ Human Uncoated ELISA kit (both from Invitrogen) and DuoSet Human IFN-gamma kit and Ancillary Reagent Kit 2 (R&D Systems ...
-
bioRxiv - Immunology 2022Quote: ... rat anti-human (16G6) and rabbit anti-human polyclonal CD49a were all purchased from ThermoFisher. For collagen measurements 10 mg of allograft tissue/sample was analyzed with a Hydroxyproline Assay Kit (Sigma ...
-
bioRxiv - Pathology 2022Quote: ... Aβ42 human ultrasensitive ELISA Kit and Tau (phospho) [pT231] human ELISA Kit from Thermo Fisher, and sAPPα and sAPPβ ELISA Kit from Mybiosource ...
-
bioRxiv - Genomics 2021Quote: ... surviving human leucocytes in thawed samples were removed using anti-human CD45 DynaBeads (ThermoFisher Scientific). The resulting parasite pellet was washed to remove soluble human DNA (hDNA) ...
-
bioRxiv - Genomics 2022Quote: Human total RNA was extracted from THP-1 human cells using TRIzol (ThermoFisher, cat# 15596026) as per manufacturer instructions ...
-
bioRxiv - Immunology 2023Quote: ... human kinome panel (Cat # 4475388) and human stem cell openarray panel (Cat # 4475390, ThermoFisher, USA). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 10% (v/v) fetal calf serum (FCS) and 1% penicillin/streptomycin (Gibco). BT-549 and HCC1806 were cultured in Roswell Park Memorial Institute medium (RPMI ...
-
bioRxiv - Immunology 2021Quote: ... The signals were read at 450 nm using accuSkan FC microplate photometer (Fisher Scientific).
-
bioRxiv - Molecular Biology 2021Quote: ... Fab and Fc regions were separated using a Nab Protein A column (Thermo Scientific). Fabs were concentrated up to ~1 mg/mL using an Amicon Ultra 0.5 filter (10k cut-off ...
-
bioRxiv - Molecular Biology 2021Quote: ... SDM79 and SDM80 were supplemented with 7.5 mg/l hemin and 10% FCS (Invitrogen), and cells were grown at 27°C continuously in these media ...
-
bioRxiv - Immunology 2022Quote: ... and binding to Fc receptors was blocked using CD16/CD32 (clone 93, eBioscience/ThermoFisher). Cell numbers were calculated using counting beads (123count eBeads ...
-
bioRxiv - Cancer Biology 2019Quote: ... and 10% FCS and 100 units/mL Penicilium and 100 μg/mL Streptomycin (Gibco). To generate overexpressing cells ...
-
bioRxiv - Cancer Biology 2019Quote: ... DNA constructs for Fc-NKG2D molecules were expressed in Expi293TM cells (Thermo Fisher Scientific) and dimeric secreted protein was purified by Protein A affinity chromatography (PierceTM #20334 ...
-
bioRxiv - Physiology 2020Quote: ... The ELISA was read using a filter-based accuSkan FC micro photometer (Fisher Scientific). The limits of sensitivity were > 0.188 ng/ml and > 0.375 ng/ml for MUC5AC and MUC5B ...
-
bioRxiv - Bioengineering 2021Quote: ... cells were blocked with an anti-Fc Receptor polyclonal antibody (Invitrogen 14-9161-73) for 30 minutes ...
-
bioRxiv - Biophysics 2021Quote: ... point FCS measurements with Alexa Fluor® 488 (Thermo Fisher Scientific, Waltham, MA, USA) dissolved in water at 20 nM were performed at the same laser power ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 2% v/v heat-inactivated FCS and sodium bicarbonate (Gibco 25080-060). Diluted compounds were then mixed with EGFP-expressing Vero E6 cells at 25,000 cells/well in 96-well plates (Greiner Bio-One ...
-
bioRxiv - Microbiology 2021Quote: ... supplemented with 10% fetal calf serum (FCS) and 1% of Penicillin-Streptomycin mixture (Gibco) at 37°C 5% CO2 ...
-
bioRxiv - Synthetic Biology 2021Quote: ... followed by incubation with HRP-conjugated goat anti-Fc antibody (Invitrogen, catalog number A18817). Stained cells were visualized using KPL TrueBlue peroxidase (SeraCare ...
-
bioRxiv - Immunology 2020Quote: ... Washing medium consisted of 2% FCS and 2% P/S in RPMI 1640 (Gibco). FACS buffer contained 2% FCS and 2mM EDTA in PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Absorbance at 450 nm was read using an accuSkan FC microplate reader (Fisher Scientific) with SkanIt software (Fisher Scientific) ...