Labshake search
Citations for Thermo Fisher :
1401 - 1450 of 10000+ citations for 5 2 3 Difluorophenyl 5 oxovaleric acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... equipped with a PEPMAP100 C18 5 µm 0.3 x 5 mm trap (Thermo Fisher Scientific) and an HSS-T3 C18 1.8 μm ...
-
bioRxiv - Cell Biology 2024Quote: ... Peptides were enriched with μ-Precolumn (0.3 mm i.d. × 5 mm, 5 μm, Thermo Scientific) and separated on an AURORA column (0.075 mm i.d ...
-
bioRxiv - Cell Biology 2024Quote: ... 5 mg/ml IgG (Kiovig, Shire) and 5% FcR in Superblock blocking buffer (Thermo Fisher) at room temperature for 2 h ...
-
bioRxiv - Cell Biology 2024Quote: ... Blocking buffer was either 5% skim milk or 5% BSA in Tris-buffered saline (ThermoFisher) with 0.1% Tween-20 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... Peptides were enriched using μ- Precolumns (0.3 mm i.d. × 5 mm, 5 μm; Thermo Scientific) and separated on AURORA columns (0.075 mm i.d ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were pulsed with 10µM 5-Ethynyl-2’deoxyuridine (EdU) for 2 hours following manufacturer’s instructions (Click-iT® EdU Alexa Fluor® Imaging Kit, Life Technologies). Cells were subsequently fixed and stained with Hoechst 33342 ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Neuroscience 2022Quote: ... and 12 old (21 months) male C57BL/6 animals (combined over 2 independent experiments) were intraperitoneally injected with 5-ethynyl-2’- deoxyuridine (EdU) (Fisher Scientific, A10044) (resuspended in PBS at 5 mg/mL ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were loaded onto a 2 cm pre-column (C18, 5 μm, 100 A°, 100 μ, 2 cm Nano-viper column # 164564, Thermo Scientific) at 5 μl/minute flow rate using loading pump for about 5 minutes and then resolved the peptides on a 50 cm analytical column (C18 ...
-
bioRxiv - Cell Biology 2022Quote: ... 2’,7’-Bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM) was purchased from Molecular Probes (Invitrogen, Carlsbad, CA, USA). Fluorescein isothiocyanate (FITC)- and tetramethylrhodamine (TRITC)-conjugated goat anti-mouse and rabbit IgG antibodies were purchased from Jackson ImmunoResearch (West Grove ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 ng/mL recombinant murine interleukin-3 (IL-3) (Gibco). Cells were grown in a humidified incubator at 37 °C and 6% atmospheric CO2 ...
-
bioRxiv - Microbiology 2020Quote: ... and probe E_Sarbeco_P1 (5′-FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ-3′) using the TaqPath 1-Step Multiplex Master Mix kit (Applied Biosystems) on a QuantStudio 5 real-time PCR system (Appiled Biosystems) ...
-
bioRxiv - Developmental Biology 2021Quote: ... guide RNA for RBPMS2 (sequence 5’-GTCTTGCAGTGAGCTTGATC-3’) was synthesized using the T7 MegaShortScript transcription kit (Thermo Fisher Scientific). We previously described methods 28 to generate a doxycycline - inducible Cas9 line in the WTC-11 iPSC background (Coriell Institute) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 nM biotinylated 685-bp DNA fragment (68% AT; Table S2) coupled to 3 μL M280 streptavidin dynabeads (ThermoFisher) was incubated with 5 nM prey DNA and H-NS in supplemented Filament Buffer at 5–8 μM 6:4 WT H-NS ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3.125 μM Oligo-dT30VN (IDT, 5’AGCAGTGGTATCAACGCAGAGTACT30VN-3’) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were washed 3 times with WB and nuclei were stained for 5 min with Hoechst 33342 (Life Technologies) in WB ...
-
bioRxiv - Bioengineering 2021Quote: ... 3% and 5% weight/volume (w/v) MeHA solutions were prepared in Dulbecco’s phosphate buffered saline (DPBS; ThermoFisher, 14190136) with 0.05% w/v Irgacure 2959 (I2959 ...
-
bioRxiv - Biochemistry 2020Quote: ... The staining solutions contained 5 μM CM-H2DCFDA or 3 μM MitoSOX™ (both Thermo Scientific, MA, Waltham, USA) diluted in HEPES/HSA for the detection of intracellular or mitochondrial ROS ...
-
bioRxiv - Neuroscience 2020Quote: ... the slices were rinsed 3 times in PBS and incubated in PBS with DAPI (5 μg/ml, Invitrogen, #D1306) and the following secondary antibodies at 4°C for 24 h ...
-
bioRxiv - Microbiology 2020Quote: ... a DNA fragment comprising the entire coding region of kpfR plus approximately 550 pb of 3’ and 5’ flanking regions (Table S4 in the supplemental material) was inserted on pCR2.1-TOPO vector (Invitrogen) previously cloned with erythromycin-resistance gene ...
-
bioRxiv - Cell Biology 2021Quote: ... and lifted for 3 min at 37°C using 5 mL of TrypLE Express (Invitrogen, Gibco, Cat no. #1260501). The appropriate number of cells were then spun down at 90 x g for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... and lifted for 3 min at 37°C using 5 mL of TrypLE Express (Invitrogen, Gibco, Cat no. #1260501). The appropriate number of cells were then spun down at 90 x g for 10 min at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... washed 3 times with PBS 5 min each and mounted on glass slides using Prolong Diamond antifade reagent (Invitrogen). We prepared antibodies in PBS containing 3% BSA ...
-
bioRxiv - Neuroscience 2021Quote: ... a staining solution of 1 mg/mL 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal, Invitrogen), 1× citratesodium phosphate buffer (pH 6.0) ...
-
Molecular architecture determines brain delivery of a transferrin-receptor targeted lysosomal enzymebioRxiv - Neuroscience 2021Quote: ... Sections were then rinsed in 1xPBS/0.05% Tween for 3 rounds of 5 minutes and incubated in DAPI (Invitrogen Molecular Probes D1306 ...
-
bioRxiv - Neuroscience 2021Quote: ... slides were washed in 3×5’ PBS and incubated in goat-α-rabbit-555 (1:1000, Life Technologies, A21207) in PBS for 90’ ...
-
bioRxiv - Neuroscience 2020Quote: ... the sections were washed in 0.1 M TB (3 ×5 minutes) and then incubated in goat anti-chicken Alexa 488 (1:1000, #A11039, Invitrogen), goat anti-rabbit Alexa 568 (1:500 to 1:1000 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Red blood cells were removed by treatment with 3-5 mL of ACK lysis buffer (Gibco, Cat. No. A1049201) and a subsequent washing step in RPMI 1640 with 10% FBS ...
-
bioRxiv - Cell Biology 2020Quote: ... These duplex reactions were run in triplicate (3 wells) on a QuantStudio 5 Real-Time PCR System (Thermo Fisher). One of two duplex assay pairings were used for each experiment ...
-
bioRxiv - Pathology 2020Quote: ... reverse primer 5’-cgaactCCG AGT TTA TAC TGC CCA GTT CG-3’ with FAM-labeled LUX (Cat. no19450335, Invitrogen). The mouse Vascular Endothelial Growth Factor assay ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Genetics 2020Quote: ... Samples (5 μL each) were loaded into wells of a NuPAGE Tris-acetate 3 – 8% polyacrylamide gel (ThermoFisher Scientific) and electrophoresed for 60 min at 15 volts/cm ...
-
Molecular architecture determines brain delivery of a transferrin-receptor targeted lysosomal enzymebioRxiv - Neuroscience 2021Quote: ... Sections were rinsed in 1xPBS/0.05% Tween for 3 rounds of 5 minutes followed by incubation in secondary antibody (Invitrogen: Goat anti-rat Alexa Fluor 555 ...
-
bioRxiv - Cancer Biology 2021Quote: ... LDHC expression was quantified by specific 5′FAM-3′MGB Taqman gene expression primer/probe sets (Hs00255650_m1, Applied Biosystems). MAP1B expression was quantified using primers for SYBR-based qPCR (F ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Il36A_rev (5′-CAGTTCTTGGGTCAGAATGAGTG-3′) and subsequent cloning into pJET1.2/blunt vector as described by the manufacturer (ThermoFisher Scientific). The DNA fragment encoding mouse C/EBPβ residues 221–296 (bZIP domain ...
-
bioRxiv - Genomics 2021Quote: ... 0.5μM oligo-dT (IDT; 100uM 5′-biotin-ACGAGCATCAGCAGCATACGA-T30VN-3′) and 0.5mM dNTPs/each (Thermo Fisher; 25 mM each) and snap frozen at −80 °C ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The full structure of the NUKU2 transcript was determined with 5’ and 3’ RACE using the GeneRacer kit (Invitrogen), and testicle total RNA (Ambion ...
-
bioRxiv - Immunology 2022Quote: ... PBMCs were cultured at 37°C with 5% CO2 for 3 days in RPMI-1640 medium (Thermo Fisher Scientific) supplemented 10% FCS (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... for 15 minutes at room temperature and then washed 3 times for 5 minutes each with pH 7.4 Phosphate Buffered Saline (PBS) (Gibco). Cells were then simultaneously permeabilized and blocked with a solution of 0.25% Surfact-Amps X-100 (Thermo Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 5.5 and 100 μM 3′,5′-dimethoxy-4′-hydroxyacetophenone (acetosyringone) (115540050; Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (D8418 ...
-
bioRxiv - Neuroscience 2022Quote: ... Slides were rinsed 3 x 5 min and cell nuclei were labeled by DNA staining using Hoechst (Life Technologies) for 30 min at RT ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3.125 µM Oligo-dT30VN (IDT, 5′-AAGCAGTGGTATCAACGCAGAGTACT30VN-3′) and 1:600,000 ERCC RNA spike-in mix (Thermo Fisher, 4456740)) into 384-well hard-shell PCR plates (Biorad HSP3901 ...
-
bioRxiv - Microbiology 2024Quote: ... falciparum (3D7, Dd2, and HB3) parasites were cultured in 3-5% human O+ RBCs in RPMI-1640 (Gibco, 110875093) complete medium containing 0.5% Albumax-II (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... 0,5µM Smartseq3 OligodT30VN (IDT; 5’-Biotin-ACGAGCATCAGCAGCATACGAT30VN-3’) adjusted to RT volume and 0,5mM dNTPs/each (Thermo Fisher, #R0181). After cell sorting lysis plates were centrifuged before storage at -80°C ...
-
bioRxiv - Bioengineering 2022Quote: ... organoids were washed 3 times for 5 minutes each using PBS and mounted on glass microscope slides (Fisher Scientific). 90 μm Polybead Microspheres (Polyscience ...
-
bioRxiv - Cancer Biology 2023Quote: ... the sample was washed 3 x 5 min with PBS and mounted in Fluoromount-G (ThermoFisher, 00-4958-02). 15 samples per genotype were prepared and photographed using a tile scan at a confocal microscope Zeiss LSM780 (Zeiss ...
-
bioRxiv - Cell Biology 2023Quote: ... boiled at 95°C for 5 min and loaded into a NuPAGE 3-8% Tris-Acetate Gel (Thermo Scientific) along with HiMark™ Pre-stained Protein Standard (Thermo Scientific LC5699) ...
-
bioRxiv - Immunology 2023Quote: ... Slides were washed extensively (3 x 5 mins) in TBS-tween20 and incubated in appropriately labeled secondary antibodies (Invitrogen) for 1 h at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Following preset incubation times (0, 0.5, 1, 3, or 5 h) cells were harvested by trypsinization (500 μl TrypLE, Gibco) for 5 min at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... coverslips were washed once with 0.1M MOPS buffer (pH 3) and stained with 50 μg / ml 5,(6)-Carboxyfluorescein Diacetate (CFDA) (Invitrogen) in MOPS buffer for 1 h at 37°C in the dark ...