Labshake search
Citations for Thermo Fisher :
1351 - 1400 of 10000+ citations for Recombinant Mouse Fgfr1 Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2023Quote: All recombinant proteins were produced in Expi293F cells (Thermo Fisher Scientific) by transient transfection ...
-
bioRxiv - Biochemistry 2024Quote: ... Recombinant murine pro-CtsK were expressed in 293-Freestyle cells (ThermoFisher) by transient expression using FectoPRO transfection reagent (Polyplus transfection) ...
-
bioRxiv - Biophysics 2024Quote: ... The recombinant DR2539 was expressed in Escherichia coli BL21 (DE3) (Invitrogen). The cells were grown at 310 K to an OD600 of ≈ 0.6 in Luria-Bertani medium containing 100 µg ml-1 of ampicillin ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Biochemistry 2022Quote: All recombinant proteins were expressed in Escherichia coli BL21 DE3 (Invitrogen), in LB medium ...
-
bioRxiv - Immunology 2023Quote: Recombinant gp120s were produced via transient transfection using Freestyle 293F (ThermoFisher) or 293S GnT1- cells and 293Fectin using the same conditions as SOSIP gp140s ...
-
bioRxiv - Developmental Biology 2023Quote: ... 50 ng/ml recombinant human epidermal growth factor (Invitrogen, Waltham, MA), and 5 μg/ml of follicle-stimulating hormone (Bioniche Animal Health ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 ng/ml human recombinant epidermal growth factor (Fisher Scientific PHG0311), 5 mM glucose (Fisher Scientific A2494001) ...
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 ng/mL human EGF recombinant protein (Life Technologies, Cat: PHG0311), and 100 IU/mL P/S ...
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... VEGF ligand (recombinant human protein) was ordered from ThermoFisher (CAT: #PHC9391).
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 20 ng/ml human basic FGF recombinant protein (bFGF) (Gibco, 13256029), 2% B27 supplement (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 20 ng/ml human EGF recombinant protein (Gibco, PHG0314), 20 ng/ml human basic FGF recombinant protein (bFGF ...
-
bioRxiv - Cell Biology 2024Quote: ... RNaseOUT Recombinant Ribonuclease Inhibitor (40 U/1 µL, Thermo Fisher Scientific), Universal RNA Spike II (0.005 ng/µL ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2.5 ng/mL recombinant human hepatocyte growth factor (Gibco, UK).
-
bioRxiv - Biophysics 2024Quote: Recombinant baculoviruses were produced using the Bac-to-Bac system (Invitrogen) and infected Spodoptera frugiperda (Sf9 ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant plasmids were transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen) together with lentiviral packaging vectors pMD2.G and psPAX2 (gifts from Didier Trono ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.5 uL Taq DNA Polymerase Recombinant (5u/ uL) (Invitrogen, Catalog #10342020), and 0.5 uL dsH2O to a total of 22.5 uL ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Sybr Safe DNA gel stain and BenchMark™ His-tagged Protein Standard were purchased from Invitrogen. HRP-conjugated 6*His His-Tag Mouse McAB was obtained from Proteintech ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... His-tagged proteins were eluted from the beads in a disposable polypropylene column (29924, ThermoFisher Scientific) using elution buffer (4 ml wash buffer containing 400 mM imidazole ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... T0M20 antibodies (polyclonal, cat number PA5-52843) and Alexa 568-tagged secondary antibodies were from ThermoFisher. The imaging was performed using Nikon SP-1 microscope and analyzed using FIJI (Schindelin et al. ...
-
bioRxiv - Cell Biology 2019Quote: Creation of the 3xmEGFP tagged RabE12 construct occurred by a two-element LR Gateway reaction (ThermoFisher) of entry clones pENT-L1-3xmEGFP-L5r and pENT-L5-RabE12-L2 ...
-
bioRxiv - Neuroscience 2020Quote: ... N-terminally HA-tagged AMPAR constructs were expressed from the doxycycline inducible pcDNA4/TO vector (Invitrogen Cat ...
-
bioRxiv - Biochemistry 2021Quote: Immunoprecipitation of HA tagged GAPDH (TDH3-HA) was performed using Pierce anti-HA beads (Thermo Fisher). Briefly ...
-
bioRxiv - Biochemistry 2021Quote: ... 200 μl and the tagged Aβ(1-40) is incubated with Ulp1 SUMO-protease (either Invitrogen or produced recombinantly (Malakhov ...
-
bioRxiv - Neuroscience 2020Quote: ... media was collected and His tagged proteins were bound using HisPur Ni-NTA Resin (ThermoFisher; 88221) in the presence of Calbiochem’s EDTA-free protease inhibitor cocktail 1:1000 (MilliporeSigma ...
-
bioRxiv - Biophysics 2021Quote: ... they were transfected with EGFP tagged wt LA/A350P DNA along with Lipofectamine 2000 (Invitrogen, USA) in a ratio 1:1.5 ...
-
bioRxiv - Plant Biology 2022Quote: ... His-tagged ChElp2 was pulled-down with Dynabeads™ His-Tag (Thermo Fisher Scientific, Massachusetts, USA) and the subsequent western blot analyses were performed with anti-His (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: MCF-7 Cells were fluorescently tagged with CellTracker™ Green CMTPX dye (Invitrogen™, Waltham, MA). A stock solution of 10 mM was prepared according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2022Quote: 3T3-L1 cells expressing GFP-tagged human CIDEC were incubated with MitoTracker (#M7512; Thermo Fisher Scientific) before fixation ...
-
bioRxiv - Neuroscience 2020Quote: ... In some cases 200-400 nl of fluorescent-tagged material (20% solution of FluoroEmerald Molecular Probes, Eugene ...
-
bioRxiv - Microbiology 2020Quote: The Avi-tagged BG505 gp140.664.R1 trimer probe was transiently expressed in HEK293F cells (Thermo Fisher) (67) ...
-
bioRxiv - Biochemistry 2021Quote: 1-2 μg His-tagged calcineurin was first bound to magnetic Dynabeads (Thermo Fisher Sci. USA) in base buffer (50 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein A-tagged proteins were detected with HRP-conjugated polyclonal anti-Protein A (Invitrogen, PA1-26853) at 1:5000.
-
bioRxiv - Immunology 2020Quote: ... The resultant FLAG-tagged STAT3 constructs were transfected into 293T using lipofectamine 3000 (Thermo Fisher Scientific). 48 hours after transfection cells were lysed (50mM Tris ...
-
bioRxiv - Genetics 2019Quote: ... Proteins tagged with the V5 epitope (Hxk2, Reg1) were detected with the Anti-V5 probe (Invitrogen) diluted 1:1,000 ...
-
bioRxiv - Plant Biology 2022Quote: ... GST and GST-tagged SAMS were incubated with 40 μl GST magnetic beads (Thermo Fisher Scientific) for 1 h at 4°C and then these beads were washed three times with lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Tagged gDNA was enriched using Dynabeads™ MyOne™ Streptavidin C1 (Thermo Fisher Scientific, Cat. 65001). The beads were allowed to room temperature while being resuspended on a HulaMixer™ Sample Mixer (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... the lysate supernatant containing His-tagged proteins was affinity-purified with His-Tag magnetic beads (Invitrogen) and used for pull-down assays ...
-
bioRxiv - Microbiology 2023Quote: ... we used PrepEase Histidine-tagged Protein Purification Midi Kit-High Yield (Affymetrix, Santa Clara, CA, USA) or Protino Ni-IDA 2000 packed columns (Macherey-Nagel ...
-
bioRxiv - Genetics 2023Quote: ... Flag-tagged proteins were immunoprecipitated with anti-Flag magnetic agarose (Pierce Anti-DYKDDDDK Magnetic Agarose, ThermoFisher), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with Alexa Fluor 555-tagged donkey-α-goat secondary antibody (Molecular Probes, 1:1000) for 1 hour ...
-
bioRxiv - Biophysics 2022Quote: ... The His tagged RBD construct was purified from the culture supernatant of Expi293 cells (Thermo Fisher) that were transfected with the plasmid DNA using FectoPRO (Polyplus Inc.) ...