Labshake search
Citations for Thermo Fisher :
1351 - 1400 of 10000+ citations for Potassium 3 4 difluorophenyl trifluoroborate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Developmental Biology 2020Quote: RNA from Rbx2 fl/fl (n=3) and Rbx2cKO-Nes (n=3) P1 telencephalons was extracted using TRIzol (Invitrogen). Strand-specific and barcode-indexed RNA-seq libraries were generated from 1 μg total RNA each after poly-A enrichment using the Kapa Stranded mRNA-seq kit (KapaBiosystems ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Immunology 2020Quote: 3’ RACE analysis was performed on testis and liver RNA using the 3’ RACE System kit (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Detection of active caspase 3/7 was accomplished using CellEvent™ Caspase-3/7 Red Detection Reagent (ThermoFisher Scientific). Sorted CD4SP Rag1GFP+ thymocytes were stained with CD5-PerCP-Cy5.5 (53-7.3 ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
bioRxiv - Genetics 2023Quote: 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed ...
-
bioRxiv - Cell Biology 2023Quote: ... for 30 min at room temperature using 10 mM Sodium Acetate [pH 5.0] buffer containing 5μg/ml 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Thermofisher, 22980) as coupling agent ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the human dystrophin 3′ UTR or mutant 3′ UTR and with 50 nM miR-146a mimic (Life Technologies) with Lipofectamine 2000 according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3′-ligated RNA fragments and subtracted 3′-ligated RPF fragments were reverse-transcribed using SuperScript III Reverse Transcriptase (Invitrogen) at 48 °C for 30 min ...
-
bioRxiv - Physiology 2024Quote: ... 40 μl of total blood were stained with a fluorescent lipophilic dye (3, 3′-dyhexiloxacarbocyanine iodide; DiOC6, Molecular Probes) to obtain absolute counts of erythrocytes ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... was injected into buccal mucosa of tumor-bearing KOG mice 3 times every 3 days along with 100 μg polyI:C (Invitrogen) as adjuvant.
-
bioRxiv - Cell Biology 2021Quote: ... PDMPO [2-(4-pyridyl)-5-((4-(2-dimethylaminoethyl-amino-carbamoyl)methoxy)-phenyl)oxazole] (ThermoFisher Scientific, USA) was added to a final concentration of 330 µM ...
-
bioRxiv - Microbiology 2022Quote: ... interleukin-10 (IL-10) and interleukin-4 (IL-4) levels by sandwich ELISA kits (ThermoFisher Scientific). The measurement from unstimulated splenocytes (incubated with medium only ...
-
bioRxiv - Immunology 2021Quote: ... 4°C) and cells were spun onto glass slides using a Cytospin 4 Cytocentrifuge (Thermo Scientific), dried for 10 min ...
-
bioRxiv - Cell Biology 2022Quote: ... Samples were migrated on precast Novex 4–20% or 4–12% polyacrylamide gels (Thermo Fisher Scientific), then transferred to Novex nitrocellulose membranes (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... and then fixed overnight at 4°C in 4% paraformaldehyde (Alfa Aesar, Thermo Fisher Scientific, UK), followed by several washes in 0.1M Phosphate buffered saline (PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... only 4 μL of 1 mM FM 4-64 (Cat. number T13320, Thermo Fisher, Waltham, MA) was injected ...
-
bioRxiv - Cell Biology 2023Quote: ... diluted in fresh DMEM for 4 h followed by fixation with 4% PFA (Thermo Fisher Scientific). To induce expression of the hGRAD and TRIM21 systems ...
-
bioRxiv - Physiology 2023Quote: ... 0.5 mg protein was precleared for 30 minutes at 4°C with 4% Agarose beads (ThermoFisher). To immunoprecipitate RYR1 ...
-
bioRxiv - Biochemistry 2024Quote: ... samples were run on Bolt 4–12% SDS-polyacrylamide and native PAGE 4-16% gels (Invitrogen) respectively ...
-
bioRxiv - Biochemistry 2022Quote: ... samples were run on Bolt 4–12% SDS-polyacrylamide and native-PAGE 4-16% gels (Invitrogen) respectively ...
-
bioRxiv - Systems Biology 2024Quote: ... A Dionex IonPac AS11-HC-4 µm column (250 × 0.4 mm, 4 µm; Thermo Fisher Scientific) was used at 35°C to separate metabolite ...
-
bioRxiv - Biochemistry 2024Quote: ... n=4 MCT-Vehicle and n=4 MCT-Fer-1 using PureLink RNA Mini kit (ThermoFisher) with DNase ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were next stained with 4’,6-diamidino-2-phenylindole (DAPI) (4 μg/mL) (Thermo Scientific) and analyzed using the BD LSRFortessa cell analyzer (BD Biosciences ...
-
bioRxiv - Biophysics 2020Quote: ... 4 mM glutamine GlutaMAX™ (Gibco) and 1x non-essential amino acids (Gibco) ...
-
bioRxiv - Cancer Biology 2021Quote: ... 4 mM L-glutamine (Life Technologies), 1 mM sodium pyruvate (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 μL of Lipofectin (Life Technologies) and 1 μg of plasmid ...
-
bioRxiv - Cell Biology 2020Quote: ... Isopropanol (Thermo Fisher Scientific - A416-4), LDL (Alfa Aesar - J65039) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 4% FBS (10042682; Fisher Scientific) (Placzek et al. ...
-
bioRxiv - Immunology 2021Quote: ... and 4 units of RNaseOUT (ThermoFisher). Following sorting ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 nM Calyculin A (PHZ1044; Invitrogen) or 1 mM 4-hydroxyacetophenone (278564 ...
-
bioRxiv - Developmental Biology 2021Quote: ... on the Qubit 4 fluorometer (Invitrogen). RNA quality was assessed using the RNA 6000 Nano kit total RNA assay (Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-4 (Gibco), 10 ng/ml IL-10 (Gibco) ...
-
bioRxiv - Bioengineering 2021Quote: ... in 4% horse serum (ThermoFisher, 16050122) and then incubated overnight with primary antibodies in 4% horse serum at 4 °C ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 mM Glutamax (Thermo Fisher Scientific) and 1% v/v antibiotics/antimycotics (Thermo Fisher Scientific) ...
-
bioRxiv - Bioengineering 2021Quote: ... separated on 4%-12% NuPAGE (Invitrogen), and then electroblotted onto a polyvinylidenedifluoride membrane ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with 4% horse serum (Gibco), 1% CEE and 1% (v/v ...
-
bioRxiv - Neuroscience 2020Quote: Fluo-4 AM (Thermo Fisher Scientific), a Ca2+ indicator ...
-
bioRxiv - Physiology 2021Quote: ... 4 μL Tween 80 (Fisher Scientific), 20 μL cremaphor (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... 4-chlorobenzenesulfonate salt (DiD) (Life Technologies), as described before (12) ...
-
bioRxiv - Cancer Biology 2021Quote: monoclonal antibody (Invitrogen, Clone DJR2-4) in the blocking serum at a ratio of 1:50 ...
-
bioRxiv - Cancer Biology 2020Quote: ... LAPC-4 in RPMI medium (Gibco); all were supplemented with 10% full bovine serium (FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 4-well chambered coverglass slides (Nunc) were coated with UltraPure agarose (ThermoFisher ...
-
bioRxiv - Neuroscience 2022Quote: ... or FM 4-64FX (Invitrogen: F34653), at a dose of 1.12 mg/kg of body weight from stocks made up in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... 4 U/µl RnaseOUT (ThermoFisher Scientific) and 20 U/µl of SuperScript III RT (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2022Quote: ... containing 4% B-27 (Life Technologies), 30 μM ascorbic acid (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2022Quote: ... PDCA-1 (ThermoFisher # 53-3179-4), TLR9 (Biolegend #394803) ...