Labshake search
Citations for Thermo Fisher :
1351 - 1400 of 10000+ citations for Oropouche Virus Gn Protein Human Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Plasmid transfection and virus infection: Expression constructs were transfected into cells using Lipofectamine 2000 Transfection Reagent (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... The genomic titer of each virus was determined by quantitative PCR using the ABI 7700 (Applied Biosystems) and primers specific to the WPRE ...
-
bioRxiv - Immunology 2020Quote: ... Virus detection was performed using One-Step RT-PCR SuperScript(tm) III Platinum(tm) Kit (Life Technologies). Thermal cycling was achieved at 55°C for 10 minutes for reverse transcription ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293T cells (ATCC) were cultured for virus production in Dulbecco’s Modified Eagle Medium: Nutrient Mixture (DMEM) (GIBCO) supplemented with 10% FBS and 1% P/S ...
-
bioRxiv - Microbiology 2022Quote: ... and plasmids encoding two vaccinia virus capping enzyme subunits (pCAG-D1R and pCAG-D12L −0.8μg each) using 16μL Lipofectamine 2000 (Invitrogen) per transfection reaction in a total volume of 200μL of Opti-MEM (Gibco) ...
-
bioRxiv - Microbiology 2022Quote: ... Real-time RT-PCR analysis was performed using Fast Virus 1-Step Master Mix (Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... half of the virus supernatant after the concentration step was digested with amplification grade DNAse I (Invitrogen/Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... iPSC lines were generated using the Sendai virus (CytoTuneTM-iPS 2.0 Sendai Reprogramming Kit, Thermo Fisher Scientific) carrying the Yamanaka reprogramming factors OCT3/4 ...
-
bioRxiv - Microbiology 2023Quote: ... The BA.1 and BA.2 supernatants were additionally concentrated using the Intact Virus Precipitation Reagent (Invitrogen). All viral stocks were stored at -80°C until use ...
-
bioRxiv - Molecular Biology 2024Quote: ... HEK293T cells used for the production of virus were cultured in DMEM supplemented with 2mM glutamine (Gibco), 10% Tetracycline-free FBS (Sigma-Aldrich ...
-
Resolution of SARS-CoV-2 infection in human lung tissues is driven by extravascular CD163+ monocytesbioRxiv - Immunology 2024Quote: ... cells were infected with virus diluted in 10 mL of Opti-MEM (ThermoFisher Scientific, Waltham, MA, USA) and incubated for 1 h at 37°C to allow for virus adsorption ...
-
bioRxiv - Microbiology 2024Quote: ... and the virus was incubated with 25 μg of Alexa Fluor 488 NHS Ester (succinimidyl ester; Invitrogen) for 1 hour at 25°C ...
-
bioRxiv - Biochemistry 2023Quote: ... This virus mixture was used to infect 1.8–2.4 liters of High Five cells (Thermo Fisher Scientific) at a cell density of 3 × 106 per ml for 60 h at 27°C ...
-
bioRxiv - Cell Biology 2023Quote: ... from a cDNA library of HCT116 which was prepared using Moloney murine leukemia virus reverse transcriptase (Invitrogen), as described previously (Ninagawa et al. ...
-
bioRxiv - Microbiology 2024Quote: Genomic DNA was extracted from 1010 virus particles using the PureLink TM Genomic DNA mini kit (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... medium containing virus was processed by centrifugation (Sorvall WX-90 Ultracentrifuge and SureSpin 630 rotor; ThermoFisher Scientific), using a sorbitol cushion (20% sorbitol ...
-
bioRxiv - Neuroscience 2023Quote: Expanded PBMCs were transduced Sendai virus reprogramming vector – according to CytoTune® 2.0 Sendai (Thermo Fisher Scientific). Before cells infection ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified gRNA from benzonase-treated virus material was treated with DNaseI (Thermo Fisher Scientific, Waltham, MA, USA), and analyzed using an Agilent 2100 bioanalyzer (Agilent Technologies ...
-
bioRxiv - Genetics 2023Quote: ... The PBMCs were reprogrammed by using Sendai virus (CytoTuneTM-iPS 2.0 Sendai Reprogramming kit, Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The following primary antibodies were used: influenza A virus nucleoprotein (NP, PA5-32242, 1:3000, ThermoFisher Scientific), XPO1 (46249S ...
-
bioRxiv - Molecular Biology 2023Quote: ... Isolated ZIKV RNA was titrated by qRT-PCR using TaqMan Fast virus 1-step master mix (ThermoFisher) and a LightCycler 480 or LC96 instrument (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... Presence of each virus strain in the supernatant was determined by PCR using Taq polymerase (Thermo Scientific) and 20 μL reactions containing 1 μL of virus supernatant ...
-
bioRxiv - Bioengineering 2023Quote: ... reverse transcription was performed with random hexamers and Moloney murine leukaemia virus (M-MLV) reverse transcriptase (Invitrogen). Synthesized RNA was used as a standard (BEI) ...
-
bioRxiv - Microbiology 2023Quote: ... Infectious virus was reconstituted by transfecting ARPE-19 cells with BAC DNA and Lipofectamine 3000 (ThermoFisher L3000001); high titer stocks generated after three passages in ARPE-19 cells were used for this project ...
-
bioRxiv - Microbiology 2023Quote: ... infected cells were stained with primary antibody (Vaccinia Virus Polyclonal FITC Antibody ThermoFisher PA1-73191, 1:1000) and Hoechst 33342 (1:10,000) ...
-
bioRxiv - Biochemistry 2023Quote: ... virus was harvested by collecting supernatant and filtering it through 0.45µm PES sterile filter (Thermo Fisher, 2954545). Virus was concentrated by ultracentrifugation with a 20% sucrose cushion ...
-
bioRxiv - Microbiology 2023Quote: ... cells were washed twice with PBS and then incubated with virus suspended in infectious medium (DMEM; Invitrogen) supplemented with 35% bovine serum albumin (BSA ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was reverse transcribed using the Moloney Murine Leukemia Virus Reverse Transcriptase Kit (Thermo Fisher Scientific, #28025013) with random hexamers (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... protein concentrations were determined by Bradford Protein Assay protein using Coomassie protein assay reagent (Thermo Fisher Scientific-Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...