Labshake search
Citations for Thermo Fisher :
1351 - 1400 of 10000+ citations for Mouse OLFR139 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: All constructs were sub-cloned into pcDNA 3.1 plasmid (Invitrogen). The plasmids pcDNA3.1-F36M-FKBP(Fm)-emGFP-hFt and pcDNA3.1–Fm–hFt were previously described32 ...
-
bioRxiv - Genetics 2020Quote: Plasmid constructs were generated performing Multi-Site Gateway cloning (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Plasmids were constructed using two-slot Gateway Cloning system (Invitrogen) and confirmed by restriction digest and/or sequencing as appropriate ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1.5 µg target plasmid DNA using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Assembled plasmids were transformed into Mach1 competent cells (Invitrogen #C862003) for amplification and purified with miniprep (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: Plasmid transfections were performed using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... Each synonymous plasmid mixed with turbofect reagent (12331863, Fisher scientific) was added in each well and cells were sampled at day 2 (Trypsin-EDTA ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmids were digested with EcoRI (ThermoFisher, Scientific, Waltham, MA) and RNA was in vitro transcribed using mMESSAGE mMACHINE Sp6 Transcription Kit ...
-
bioRxiv - Cell Biology 2022Quote: Plasmid transfections were performed using Lipofectamine 2000 (Thermo Fisher Scientific) and siRNA transfections were performed using Lipofectamine RNAiMAX (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... For further processing the GeneJET Plasmid Miniprep Kit (Thermo Fisher) was utilized as instructed ...
-
bioRxiv - Molecular Biology 2022Quote: ... coli with either PureLink™ HiPure Plasmid Midiprep Kit (Invitrogen) or PureLink™ HiPure Plasmid Miniprep Kit (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plasmids were transfected by lipofectamine LTX transfection reagent (ThermoFisher Scientific) in HEK293-T cells plated the day before in 6-well plates at approximately 70% confluence (800000 cells/well) ...
-
bioRxiv - Plant Biology 2022Quote: ... and ligation into pGEM-T plasmids (ThermoFisher Scientific, manufacturer’s conditions) of the PCR fragments were conducted for sequencing and probe preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with reporter plasmids using Lipofectamine 3000 (ThermoFisher) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... PureLink Pro Quick96 Plasmid Purification Kit (K211004A, Thermo Fisher Scientific) and Mini Plus Plasmid DNA Extraction System (GF2002 ...
-
bioRxiv - Neuroscience 2022Quote: ... Plasmids were amplified using DH5α competent cells (Thermo Fisher Scientific) and purified with the Endofree Plasmid Maxi Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2022Quote: ... the constructed plasmid was transformed into DH10Bac (Thermo Fisher Scientific). After transformation ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were transfected with plasmid DNA using Lipofectamine 3000 (Invitrogen) according to manufacturer’s instruction (∼2 µg DNA per 1 × 106 cells).
-
Rationally designed protein bandpass filters for controlling cellular signaling with chemical inputsbioRxiv - Synthetic Biology 2023Quote: ... plasmid DNA mixed with 50 μL opti-MEM (Thermo Fisher) and 600 ng of polyethyleneimine (24765-1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and cloned it in the pcDNA3.1/myc-His(-) plasmid (Invitrogen) in frame with a Myc-His tag to obtain the wild-type (WT ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with plasmid constructs using lipofectamine 3000 (Invitrogen) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... plasmids were used to transfect EXPI293F cells (Thermo Fisher Scientific) using 1 μg DNA/ml of cells with a ratio of light chain:heavy chain of 3:2 ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmids were recombined by addition of LR Clonase II (Invitrogen) with overnight incubation at 25°C ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmids were recombined by addition of LR Clonase II (Invitrogen) with overnight incubation at 25°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified using the PureLink™ HiPure Plasmid Miniprep Kit (Invitrogen), into the gonad of 1 day-old adult animals of the MosSCI acceptor strains ...
-
bioRxiv - Bioengineering 2023Quote: ... and isolated using a GeneJET plasmid miniprep kit (Thermo Fisher). Sequencing was performed by ELIM Biopharmaceuticals ...
-
bioRxiv - Neuroscience 2023Quote: ... were transfected with the plasmids using Lipofectamine 3000 (Thermo Fisher) and cultured for 2 days at 37 °C and 5 % CO2 ...
-
bioRxiv - Neuroscience 2023Quote: ... Plasmids were transfected into HeLa cells using Lipofectamine 3000 (Invitrogen). Imaging was performed 24-48 h following transfection in a HEPES-buffered ACSF solution (20 mM HEPES pH 7.3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and transforming the cloned plasmids into MAX EFFICIENCY DH10BAC (GIBCO) or EmBacY (Geneva Biotech ...
-
bioRxiv - Microbiology 2023Quote: ... were cloned into a pFRT expression plasmid (Thermo Fisher Scientific) in frame with an N-terminal Gaussia luciferase (Gluc ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNAs were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The plasmid pcDNA6.2/N-EmGFP-DEST obtained from Invitrogen (ThermoFisher). The CMV promoter ...
-
bioRxiv - Genomics 2023Quote: ... and 1µg of gRNA plasmid using Neon electroporation (Life Technologies). A week after transfection ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmids were recombined by addition of LR Clonase II (Invitrogen) following the manufactures instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... coli colonies using the GeneJET Plasmid Miniprep Kit (ThermoFisher Scientific). The variable region of the library (position 19 to 83 ...
-
bioRxiv - Immunology 2022Quote: ... and cloned into the plasmid vector pJet (Thermo Fisher Scientific). The mRNA was synthesized by in vitro transcription using a DNA template with T7 promoter Φ6.5 (TAATACGACTCACTATAGGG) ...
-
bioRxiv - Microbiology 2023Quote: ... protein expression from plasmid (derivates of pBAD-His/B (Invitrogen) in all cases except expression of VirF from pCL5 [71] ...
-
bioRxiv - Biophysics 2023Quote: ... Plasmid DNAs were transfected using Lipofectamine 2000 (Thermo Fisher Scientific), according to the manufacturer’s protocol ...
-
bioRxiv - Biophysics 2023Quote: ... plasmid was diluted in OptiMEM media (Reduced Serum Media, Gibco), mixed with PEI solution diluted in OptiMEM (3 μL PEI/μg DNA) ...
-
bioRxiv - Cell Biology 2023Quote: ... and/or the indicated plasmid with Lipofectamine 2000 (Thermo Fisher, 24 h after RNAi treatment or 24 h before imaging/harvesting) ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA and plasmid transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... plasmids were transformed into chemically competent BL21(DE3) cells (Invitrogen) and grown overnight for 12–16 h at 37°C in 5 ml starter cultures in 2xYT medium with 50 μg/mL of kanamycin ...
-
bioRxiv - Plant Biology 2023Quote: ... Plasmid was transformed into Escherichia coli electrocompetent cells (Invitrogen, USA) following the manufacturer’s provided protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... both plasmids were diluted in OptiMEM (51985, Thermo Fisher Scientific) at a concentration of 50 ng/mL and a Lipofectamine™ 2000 (11668 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 µg plasmid DNA in 100 µl DMEM (Thermofisher, 41965039) without penicillin-streptomycin were combined with 2.4 µl Polyethylenimin (Sigma ...
-
bioRxiv - Biophysics 2023Quote: ... The template plasmids were digested by DpnI (Thermo Fisher Scientific), and the digested PCR products were ligated by Ligation High (TOYOBO) ...
-
bioRxiv - Cell Biology 2023Quote: ... and packaging plasmids using lipofectamine 2000 (Thermo Fisher Scientific, 11668019) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... This plasmid was transformed into BL21(DE3) cells (Thermo Fisher) and purified using nickel Sepharose as described (Buser et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... for plasmid DNA transfection or Lipofectamine 2000 (Thermo Fisher Scientific) for siRNA transfection or co-transfection of siRNA with plasmid DNA ...
-
bioRxiv - Microbiology 2023Quote: ... coli DH5α cultures using the GeneJET Plasmid Miniprep (Thermo Scientific), following the manufacturer’s instructions ...