Labshake search
Citations for Thermo Fisher :
1351 - 1400 of 10000+ citations for 7 Chloro 3 nitro 3 4 dihydro 1H quinolin 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... The Gibson reaction mix was transformed into Mach1 competent cells (4 μl Gibson into 40 μl cells, 288 reactions in 3×96-well plates) following manufacture’s protocol (Invitrogen C862003). After transformation ...
-
bioRxiv - Cell Biology 2022Quote: ... at 180V on precast either NuPAGE Novex 4-12% Bis-Tris Gels in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen), or NuPAGE™ 3-8% Tris-Acetate gels in NuPAGE™ Tris-Acetate SDS Running Buffer (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: ... The cells were passaged every 3-4 days after they achieved confluency of 80-90% using Trypsin 0.25% EDTA (Life Technologies).
-
bioRxiv - Neuroscience 2022Quote: ... the cell cultures were washed 3 times with 37 °C DPBS+ and fixed using 4% w/v paraformaldehyde (PFA; Affymetrix) in PBS for 2.5 h ...
-
bioRxiv - Genetics 2022Quote: ... LC-MS/MS based proteomics datasets (4 groups × 3 replicates) were then generated in a lab (code: NVG) using Q Exactive HF-X mass spectrometer (ThermoFisher). To eliminate confounding factors such as experimental sample-processing order with sample group ...
-
bioRxiv - Neuroscience 2022Quote: ... slices for optical recordings were incubated for 30 minutes in oxygenated Krebs solution added to a 3% Di-4-ANEPPS (Invitrogen) stock solution and mixed with an equal volume of fetal bovine serum (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: ... mRNA samples of 4 ng were subjected to DNaseI treatment and 3’ dephosphorylation using FastAP Thermosensitive Alkaline Phosphatase (Thermo Scientific) and T4 PNK (NEB ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were fixed with 4% PFA for 20 min at RT and then washed (3×) in DPBS with calcium and magnesium (DPBS +/+, Gibco Invitrogen). For structural proteins ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% CO2 in a humidified incubator and were passaged every 3-4 days using 0.05% Trypsin-EDTA (ThermoFisher Scientific, 25300). Stable U2OS-derived cell lines ...
-
bioRxiv - Immunology 2023Quote: ... The cells were then blocked at 4℃ for 15 mins in 200 µl CyFACS buffer containing 3 µl rat serum (Invitrogen), 3 µl mouse serum (Invitrogen) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The next day cells were transfected with a mixture of 4 ug plasmid DNA and a 1:3 ratio of PEI (1mg/mL) in Opti-Mem (Gibco). Forty-eight hours later ...
-
bioRxiv - Cell Biology 2023Quote: ... and the cell bodies were removed by centrifugation (1,150 g, 3 min, 4°C; Sorvall Legend XTR, Thermo Fisher Scientific). A sucrose cushion (10 ML of 25% sucrose in HMS ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were passaged every 3-4 days at a split ratio of 1:8 following dissociation with 0.5 mM EDTA (Invitrogen AM99260G) in PBS without MgCl2/CaCl2 (Sigma-Aldrich D8662) ...
-
bioRxiv - Cell Biology 2022Quote: ... The cells were treated with either DMSO or 5 μM GolgiTracker ((BODIPY™ FL C5-Ceramide (N-(4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Pentanoyl)Sphingosine)) (Invitrogen. Cat# D3521) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of total cell lysates were loaded to 4–12% Bis-Tris or 3–8% Tris-Acetate gels (Invitrogen) and transferred to 0.2 µm PVDF membranes via wet tank or semi-dry method (specified in the supplementary information) ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were resolved on NuPAGE 3-8% (wt/vol) Tris-acetate or 4-12% (wt/vol) Bis-Tris gels (Invitrogen) and transferred to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Developmental Biology 2023Quote: ... For differential glucose concentration treatments between day 2 and 3 and between day 3 and 4, N2B27 was made using DMEM/F12 without glucose (L0091-500, Biowest) and Neurobasal without glucose (A2477501, ThermoFisher). For 1X and 3X glucose concentrations ...
-
bioRxiv - Cell Biology 2023Quote: HEK293T cells (human female in origin) were cultured every 3-4 days using 0.05% Trypsin EDTA and maintained in DMEM (Gibco, 11965118) supplemented with 10% heat inactivated fetal bovine serum (iFBS ...
-
bioRxiv - Immunology 2023Quote: Following euthanasia, adult zebrafish heads (15 wpf, N=3) were fixed in a solution of 4% methanol-free formaldehyde (Thermofisher) in 60 mM HEPES buffer (pH 7.4 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were passaged every 3-4 days at a split ratio of 1:8 following dissociation with 0.5 mM EDTA (Invitrogen AM99260G) in PBS without MgCl2/CaCl2 (Sigma-Aldrich D8662) ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 µL pH 7 TE was added, then 4 µL of 3 M sodium acetate (Fisher, #S210) and 0.4 µL 15 mg/mL GlycoBlue (ThermoFisher, #AM9515) or 0.3 µL 20 mg/mL RNA-grade glycogen (ThermoFisher ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Microbiology 2024Quote: ... The clarified lysate was transferred to a 15 mL column containing 3 mL Ni-NTA Agarose affinity resin equilibrated with buffer A at 4 °C (Invitrogen). The column was washed using a gradient of Buffer A containing 20 mM ...
-
bioRxiv - Cancer Biology 2024Quote: ... then equal quantities of protein lysate (3-10 µg) were separated by SDS-PAGE using 4–12% gradient gels (Invitrogen) and transferred to PVDF membranes ...
-
bioRxiv - Molecular Biology 2024Quote: ... The enteroids were then pelleted at 300 x g for 3 min at 4 °C and washed once with advanced DMEM/F-12 basal media (Gibco). The enteroid pellet was resuspended in the desired volume of IntestiCult complete medium (Stemcell Technologies ...
-
bioRxiv - Cancer Biology 2024Quote: ... shRNA plasmids were cotransfected with the packaging and envelope plasmids using Lipofectamine 3000 at a ratio of 4:3:1 (#L3000001, Thermofisher) into LentiX cells ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were resolved on precast NuPAGE Novex 4-12% Bis-Tris Gels in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen). Samples were transferred to 0.45 µm nitrocellulose membrane (0.9 A ...
-
bioRxiv - Genomics 2020Quote: ... Samples were incubated for 1h at 4°C with Dynabeads Protein G for Immunoprecipitation (#10003D, Invitrogen, ThermoFisher Scientific). Final DNA was purified with MinElute (#28004 ...
-
bioRxiv - Genomics 2020Quote: ... Samples were incubated for 1h at 4°C with Dynabeads Protein G for Immunoprecipitation (#10003D, Invitrogen, ThermoFisher Scientific). Final DNA was purified with MinElute (#28004 ...
-
bioRxiv - Cancer Biology 2021Quote: ... clone IMAGE ID 4977050 was obtained from Source Bioscience and PCR cloned using oligos (Tet2fwd: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAatgccaaatggcagtacagt-3’ and Tet2rev: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTTtcatacaaatgtgttgtaag-3’) into pDonor221 (Invitrogen Gateway, ThermoFisher) and sequenced ...
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Immunology 2021Quote: ... iBMDMs were incubated for 3 h in 50 μM of the mitochondrial uncoupler carbonyl cyanide 3-chlorophenylhydrazone (CCCP; ThermoFisher, M20036). Control samples included ...
-
bioRxiv - Microbiology 2021Quote: ... 50 nM siRNA (IMPDH2 assay ID: s7417, sense: 5’-CCAAGAAAAUCACUCUUtt-3’; anti-sense: 5’-UUAAGAGUGAUUUUCUUGGtc-3’, Ambion by Life technologies; non-targeting control ...
-
Interaction of the Xanthomonas effectors XopQ and XopX results in induction of rice immune responsesbioRxiv - Molecular Biology 2020Quote: The wild-type copy of the xopX gene and its 14-3-3 protein binding motif mutants were cloned in the yeast two-hybrid vector pDEST32 (Invitrogen) using the Gateway cloning system (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Genetics 2019Quote: ... V2.0 vector containing gRNA inserts targeting Kmt2d exon 51 (5’-TCTGGCTCGTTCG CGTATCC-3’) and exon 53 (5’-TCCTTTGGGGATTCGCCGGC-3’) or empty vector were transfected using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
Therapy-induced lipid uptake and remodeling underpin ferroptosis hypersensitivity in prostate cancerbioRxiv - Cancer Biology 2020Quote: ... supplemented with 1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindocarbocyanine (DiI)-labelled acetylated-LDL (15µg/ml, Thermo Fischer) or DiI-labelled LDL (15 µg/ml, Thermo Fisher) and incubated at 37°C for 2 hours ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Systems Biology 2021Quote: ... The Caspase-3 assay was performed on retina sections following the protocol described above (anti-caspase 3 (Fisher Scientific, 15889738) 1:500) ...
-
bioRxiv - Biochemistry 2021Quote: EB1 was amplified from pET24d-His-TEV-EB1 plasmid using the primers 5’-CACCATGGCTGTAAACGTCTACTC-3’ and 5’-TTACTTGTAGAGCTCGTCCATGC-3’ and inserted into pENTR/D-TOPO (Invitrogen). Using Gateway LR Clonase II (Invitrogen) ...
-
bioRxiv - Biochemistry 2020Quote: ... was prepared by PCR from plasmid SB649 (20) using primers 5′-biotin-GTTGGGTAACGCCAGGG-3′ and 5′-Alexa488-GGAAACAGCTATGACATG-3′ (IDT) and Platinum Taq DNA Polymerase (Invitrogen). The PCR product was purified using DNA SizeSelector-I SPRI magnetic beads (Aline Biosciences ...
-
bioRxiv - Molecular Biology 2020Quote: ... DNA biotinylation at the 3′ end was performed using the Biotin 3’ End DNA Labeling Kit (Thermo Fisher Scientific, US) in accordance with the manufacturer’s instructions with some modifications ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Cell Biology 2021Quote: ... the mCherry-FLAG-HA-MKAKU41 gene construct was amplified using KAKUattF (5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGTTAGCAAGGGAGAAGAGG-3’) and KAKUattR (5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACGTAGCCCGTCCCCGT-3’) primers and inserted into pDONR221 vector by BP cloning (Invitrogen), to generate the MKAKU41 entry clone ...
-
bioRxiv - Cell Biology 2021Quote: ... The precore precursor gene was amplified using the forward primer 5’-ATCTAAAGCTTACCATGCAACTTTTTCACCTCT-3’ and reverse primer 5’-TAGATGGATCCCTAACATTGAGGTTCCCGAG-3’ and introduced into the pCEP vector (Invitrogen) via HindIII and BamHI restriction sites ...
-
bioRxiv - Biochemistry 2022Quote: ... bovis DSM 6328 genomic DNA with the primer pair mbxA-for 5‘-AACCTTTTCTAACACAACGAGGAGAGAC-3‘ and mbxA-rev 5‘- AAATCACTAAACACTTGGAGCCAAAATTC-3‘ and cloned into the pJET1.2 vector (Thermo Scientific). Subsequently the mbxA gene was cloned into the pSU2726 hlyA vector (60 ...
-
bioRxiv - Biochemistry 2022Quote: ... target cleavage was monitored using synthetic RNA oligonucleotides radiolabeled by ligating [5′-32P] cytidine 3′,5′-bisphosphate to the 3′ end of the target with T4 RNA ligase I (Ambion). The [5′-32P] cytidine 3′,5′-bisphosphate was prepared by incubating 1 mM cytidine 3′-monophosphate (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... amplified with primers attB1 5’-TTACTCCATGTGTCAATACCAAAA-3’ and attB2 5’-GTCCATTTTAGTTCTCGAGTCGG-3 and introduced into the pDONR207 Gateway donor vector (Invitrogen). The NTF-GFP fragment was amplified by PCR from the published construct (Deal and Henikoff ...
-
bioRxiv - Microbiology 2022Quote: ... supplemented with 150 nM v3’ template RNA (FluPolA: 5’-AGUUUGCCUGCUUCUGCU-3’, FluPolB: 5’-UAUACCUCUGCUUCUGCU-3’) and 250 µM NTP mix (ThermoFisher). 50 µM CTD peptides were added at concentrations corresponding to at least a 10-fold excess over the KD of the lowest measured affinity for a two-repeat peptide ...
-
bioRxiv - Biophysics 2022Quote: ... Texas Red-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanloamine (TR-DHPE) and Oregon Green-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (OG-DHPE) were purchased from Thermo Fisher. PLL-PEG and PLL-PEG-biotin were purchased from SuSoS AG ...