Labshake search
Citations for Thermo Fisher :
1351 - 1400 of 10000+ citations for 6 Methyl 5 4 phenyl 1 3 thiazol 2 yl 2 trifluoromethyl nicotinic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... sections were washed in PBS-T and mounted under Prolong gold fluorescence media with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, P36931).
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Alexa Fluor 488–conjugated phalloidin (#A12379) and 4’,6-diamidino-2-phenylindole (DAPI) (#1306) were obtained from Invitrogen (Carlsbad, CA, USA). IRDye800CW-labeled anti-rabbit secondary antibody (#926-32211 ...
-
bioRxiv - Neuroscience 2020Quote: ... slides were washed and stained with 4′,6-Diamidin-2-phenylindol (DAPI, 5μg/ml) before mounting coverslips with ProlongTM Gold Antifade reagent (Thermo Fisher Scientific). Images were acquired using a LSM 710 confocal microscope (Zeiss ...
-
bioRxiv - Immunology 2021Quote: ... The isolated nuclei were centrifuged at 500 x g for 5 min at 4°C and respectively resuspended with Nuclei wash buffer stained with 10 µg/ml 4′,6-diamidino-2-phenylindole (DAPI) before FACS (5mg/ml, Invitrogen D1306). After sorting using purity mode ...
-
bioRxiv - Biochemistry 2020Quote: ... Nuclei were stained with 10.9 μΜ 4’,6-diamidino-2-phenylindole (DAPI) and cover glasses were mounted in ProlongGold (Life Technologies). Cells were incubated 3x for 5 min in blocking solution to remove unbound antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were then dipped in the secondary antibody-containing buffer with the nuclear dye 4′,6-diamidino-2-phenylindole (DAPI, Cat# D1306, Life Technologies-Invitrogen ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclear staining of glass-mounted brain sections was performed by 10 min incubation with PBS containing 2.5% DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific). Sections were embedded in mounting medium containing 1,4-diazabicyclooctane (DABCO ...
-
bioRxiv - Immunology 2023Quote: ... Nuclei were detected and cover slips were attached using 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI) containing Prolong Diamond Anti-Fade (Life Technologies). Slides were imaged on a Keyence BX-X810 microscope.
-
bioRxiv - Cell Biology 2023Quote: ... A final wash with PBS was performed before mounting the cells in ProLong® Gold Antifade Mounting medium with DAPI (4’,6-diamidine-2-phenylindole)(Invitrogen).
-
bioRxiv - Bioengineering 2023Quote: ... the hydrogel is first activated with sulfosuccinimidyl 6-(4′-azido-2′-nitrophenylamino) hexanoate (Sulfo-SANPAH, Pierce, Thermo Fisher Scientific, Waltham, MA). Here the remaining washing buffer around the gel edge is removed to ensure the coating solution can be held on top of the gel ...
-
bioRxiv - Cell Biology 2023Quote: ... and coverslips were mounted using Prolong Gold Antifade Reagent with 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies, Carlsbad, CA, USA). Cells were viewed using an Olympus IX81 or Olympus BX53 epifluorescence microscope ...
-
bioRxiv - Molecular Biology 2023Quote: ... After 3 washes cells were stained with a combination of Alexa Fluor secondary antibodies and 4′,6-Diamidino-2-Phenylindole (DAPI; Molecular Probes) for 1 h at room temperature in the dark ...
-
bioRxiv - Cell Biology 2023Quote: ... and ProLong™ Gold antifade reagent with 4′,6-diamidino-2-phenylindole (DAPI) (P36941) or without (P36930) was purchased from Invitrogen.
-
bioRxiv - Molecular Biology 2024Quote: ... coverslips were mounted on glass slides using ProLong Gold antifade (4′,6-diamidino-2-phenylindole) DAPI to counterstain the nuclei (Thermofisher, #P36935).
-
bioRxiv - Cell Biology 2024Quote: ... washed with PBS and stained with a combination of Alexa Fluor secondary antibodies (Thermo) and 4’,6-Diamidino-2-Phenylindole (DAPI; Molecular Probes) for 30 min at RT ...
-
bioRxiv - Cancer Biology 2024Quote: ... RIPA Lysis and Extraction Buffer (CAT NO. 89901), and DAPI (4’,6-Diamidino-2-Phenylindole, Dilactate) (CAT NO. D3571) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2024Quote: ... unpermeabilised cells were blocked with 2% FBS/PBS for one hour with immunostaining performed as above with the inclusion of 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher) [1:1000].
-
bioRxiv - Microbiology 2022Quote: ... Roughly 1/3 of the plate (2-3 loopfuls) were added to 400 µl 1x Tris-Ethylenediaminetetraacetic acid (EDTA) pH 7.5 (Thermo Scientific, Waltham, USA) and heated at 80 ºC for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: Sample digests were acidified with formic acid to a pH of 2-3 prior to desalting using C18 solid phase extraction plates (SOLA, Thermo Fisher Scientific). Desalted peptides were dried in a vacuum-centrifuged and reconstituted in 0.1% formic acid for LC-MS analysis.
-
bioRxiv - Cancer Biology 2024Quote: ... Sample digests were acidified with formic acid to a pH of 2-3 prior to desalting using C18 solid phase extraction plates (SOLA, Thermo Fisher Scientific). Desalted peptides were dried in a vacuum-centrifuged and reconstituted in 0.1% formic acid for LC-MS analysis.
-
bioRxiv - Biochemistry 2024Quote: ... Sample digests were acidified with formic acid to a pH of 2-3 before desalting using C18 solid phase extraction plates (SOLA, Thermo Fisher Scientific). Desalted peptides were dried in a vacuum-centrifuged and reconstituted in 0.1% formic acid for liquid chromatography-mass spectrometry analysis.
-
bioRxiv - Biochemistry 2024Quote: ... Sample digests were acidified with formic acid to a pH of 2-3 before desalting using C18 solid phase extraction plates (SOLA, Thermo Fisher Scientific). Desalted peptides were dried in a vacuum-centrifuged and reconstituted in 0.1% formic acid for liquid chromatography-mass spectrometry analysis.
-
bioRxiv - Biochemistry 2024Quote: ... Sample digests were acidified with formic acid to a pH of 2-3 before desalting using C18 solid phase extraction plates (SOLA, Thermo Fisher Scientific). Desalted peptides were dried in a vacuum-centrifuged and reconstituted in 0.1% formic acid for liquid chromatography-mass spectrometry analysis.
-
bioRxiv - Microbiology 2024Quote: ... 2% B27, 1% N2, 1% MEM non-essential amino acids, 1% penicillin/streptomycin and 0.1% β-mercaptoethanol, all from ThermoFisher Scientific) supplemented with dual SMAD inhibitors (10 µM SB-431542 and 100 nM LDN-193189) ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... The culture medium was changed every 2 to 3 days and the cells were split every 5 to 7 days using 0.25% Trypsin-EDTA (Gibco), up to 20 times ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... were maintained in a water jacketed 5 % CO2 incubator and passaged every 2-3 days using trypsin/EDTA (Gibco). 1E6 cells were seeded into 6 well plates ...
-
bioRxiv - Biochemistry 2022Quote: ... 1% nonessential amino acids (1140050) and 50μM 2-mercaptoethanol (31350-010) (all Thermo Fisher Scientific unless specified), 1,000 U/ml LIF (ESGRO ESG1107 ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 M thiourea and 4% CHAPS (Thermo Fisher Scientific). Each combined replicate of samples was loaded onto a QIAshredder spin column (QIAGEN ...
-
bioRxiv - Neuroscience 2021Quote: ... flash frozen in 2-methylbutane (Fisher Scientific, 03551-4), and kept at −80°C until sliced on a cryostat (Leica ...
-
bioRxiv - Developmental Biology 2024Quote: ... 2 mL of cold 4% PFA (Thermo Scientific, 28908) in RNAse-free PBS (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5% mercapto-2-ethanol and 1X Halt Protease Inhibitor Cocktail (Thermo Scientific; 1:200). Proteins were separated using SDS-PAGE ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2′- O-methyl capture oligonucleotide (Table S1) linked to streptavidin paramagnetic beads (Dynabeads MyOne Streptavidin T1, Life Technologies). RISC was eluted with 2 nmol biotinylated competitor oligonucleotide (Table S1 ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were incubated with 0.5 µM Lipi-Deep Red neutral lipid stain (Dojindo #LD04-10) for 2 hr and 5 µg/mL Hoeschst 33342 nucleic acid stain (Invitrogen #H3570) for 30 min at 37°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Peptides were trapped at 20 μL/min in a loading solvent (2% ACN, 0.05% trifluoroacetic acid) on a 5 mm × 300 μm C18 PepMap cartridge pre-column (Thermo Fisher Scientific) for 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... were loaded at 3 μl/min for 6 min onto a 2 cm × 75 μm C18 trap column (Acclaim Pepmap 100, 3 μm, 300 Å, Thermo Scientific) in loading buffer (0.5% v/v formic acid ...
-
bioRxiv - Molecular Biology 2023Quote: ... Biotinylation of Htz1(V126C) was carried out using N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)propionamide (HPDP-Biotin) (Thermo Fisher cat. # 21341), which has a pyridyl disulfide moiety ...
-
bioRxiv - Molecular Biology 2024Quote: ... mCherry-LacI-FokI-WT and mCherry-LacI-FokI-D450A expressing vectors 24 were transfected in U2OS 2-6-3 cells using Lipofectamine LTX (Invitrogen; #15338-100) for 24 hours ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU; 5 mg per kg body weight, Invitrogen) dissolved in sterile phosphate buffer solution (PBS ...
-
bioRxiv - Microbiology 2020Quote: ... were acid digested on a hot plate using 6 mL Primar Plus grade HNO3 (68%) and 2 mL H2O2 (Thermo Fisher Scientific, Loughborough, UK). Samples were diluted with Milli-Q water (18.2 MΩ cm ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal volume of SYTOX Green (5 μM final in HBSS without Ca+2/Mg+2, Invitrogen) was added to each sample and incubated in the dark for 10 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Slices were then dipped in the secondary antibody-containing buffer with the nuclear dye 4′,6-diamidino-2-phenylindole (DAPI, Cat# D1306, Life Technologies-Invitrogen, Carlsbad, CA, USA, dilution 1:400), for 2 hours at RT ...
-
bioRxiv - Immunology 2020Quote: ... plates were incubated with 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) substrate (ABTS, Thermo Fisher Scientific) for 15 min at RT shielded from light and absorbance was measured at optical density (OD ...
-
bioRxiv - Cell Biology 2024Quote: HEK-293T cells (5×105) were seeded in 2 wells of a 6-well plate in DMEM (Thermo Fisher Scientific #12430054) supplemented with 10% fetal bovine serum (GeminiBio #100-106) ...
-
bioRxiv - Cell Biology 2021Quote: ... and THPTA in ratio 1:2:2 in HBSS (Gibco #14025092). The later two components were also dissolved in water and a stock solution of 10 mM concentration each was prepared ...
-
bioRxiv - Microbiology 2020Quote: ... and 1 ug/ml of interleukin-2 (IL-2; Gibco BRL) in complete RPMI 1640 containing 2mM L-glutamine ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a 2:2:1 molar ratio using lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... then incubated at 37C for 5 min in 2 ml M3+BPYE media containing 1 ml Turbo DNase (2 U/μL) (ThermoFisher cat. no. AM2239) per 36 ml ...