Labshake search
Citations for Thermo Fisher :
1301 - 1350 of 4764 citations for Scyliorhinin II amide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The cell number was determined (Countess II F2, Thermo Fisher Invitrogen), and 3 ∙ 107 cells were used for each sample ...
-
bioRxiv - Biochemistry 2023Quote: ... Hi Five cells grown in Sf-900 II SFM media (Gibco) at a density of 2.0 × 106 cells/mL were infected with baculovirus at 1.5% v/v ratio ...
-
bioRxiv - Biochemistry 2022Quote: ... The sen cDNA was ligated into plasmid blunt II Topo (Invitrogen) and then transformed into TOP10 competent Escherichia coli cells ...
-
bioRxiv - Biochemistry 2022Quote: ... falciparum actin II was expressed in Spodoptera frugiperda Sf9 cells (Invitrogen) at 27°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription was performed using the Superscript II RT kit (Invitrogen) with random hexamer primers (Roche ...
-
bioRxiv - Cell Biology 2023Quote: Tissues were homogenized with Qiagen TissueLyser II in Trizol reagent (Invitrogen), and cells were scrapped with Trizol reagent (Invitrogen) ...
-
bioRxiv - Genomics 2022Quote: ... Platinum™ II Hot-Start Green PCR Master Mix (2X) (Invitrogen) was used ...
-
bioRxiv - Genetics 2022Quote: ... and cDNA generated with SuperScript II reverse transcriptase (Invitrogen, Carlsbad, CA) as described in the Illumina kit ...
-
bioRxiv - Immunology 2023Quote: ... Total RNA was retro-transcribed using the superscript II polymerase (Invitrogen), in combination with random hexamers ...
-
bioRxiv - Immunology 2023Quote: ... Phusion DNA polymerase and BP Clonase II were purchased from ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... to 10 μL TaqMan Universal Master Mix II (Applied Biosystems, 4440043) was prepared for each probe ...
-
bioRxiv - Immunology 2023Quote: ... cDNA was generated with SuperScript II Reverse Transcriptase Kit (Thermo Fisher) and amplified with HiFi HotStart PCR Mix (KAPA Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was synthesized using Super Script II (Thermo Fisher, Cat# 18064014), followed by end repair ...
-
bioRxiv - Neuroscience 2023Quote: cDNA synthesis was carried out using SuperScript II Reverse Transcriptase (Invitrogen) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... and live cells were counted using the Countess II (Thermo Fisher).
-
bioRxiv - Immunology 2023Quote: ... PE-Cyanine7 Rat Anti-Mouse IgM (Clone II/41; ThermoFisher(Ebioscience); Cat#25-5790 ...
-
bioRxiv - Plant Biology 2023Quote: ... by using Gateway® LR Clonase® II enzyme mix (Invitrogen). PCR fragments of about 400-600 bp of single MtYUCs and MtPINs genes for RNAi constructs were generated on cDNA made from Medicago nodule or root RNA ...
-
bioRxiv - Genetics 2024Quote: ... we used Phusion Hot Start II DNA Polymerase (Thermo Scientific F549L) to amplify 2000 bp upstream of efk-1 start codon ...
-
bioRxiv - Neuroscience 2024Quote: ... and counted on a Countess II automated cell counter (Invitrogen AMQAX1000) to quantify viable cells.
-
bioRxiv - Molecular Biology 2024Quote: ... using a XCell II™ Blot Module (Invitrogen, Carlsbad, CA, USA). Membranes were then probed with crude SelN antibody 7637 raised in rabbit (1:500) ...
-
bioRxiv - Molecular Biology 2023Quote: Platinum SuperFi II Green PCR Master Mix (Invitrogen, cat. No. 12369010)
-
bioRxiv - Microbiology 2023Quote: ... or RS treated glass chamber slides (154526, Nunc, Lab Tek II). Overnight S ...
-
bioRxiv - Neuroscience 2023Quote: ... The RNA was reverse transcribed with Superscript II Reverse Transcriptase (Invitrogen). The cDNA samples that passed quality control were used to generate sequencing libraries using the Nextera XT DNA Library Preparation Kit (Illumina) ...
-
bioRxiv - Biochemistry 2023Quote: ... reverse transcription was performed with Superscript II reverse transcriptase (Thermo Scientific) at 42 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Phire Green Hot Start II PCR Master Mix (Thermo Fisher, #F126L) was used according to manufacturing instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... pEarleyGate104 and pEarleyGate201 destination vectors (56) via LR Clonase II (Invitrogen) from their entry vectors ...
-
bioRxiv - Biophysics 2023Quote: Sf9 cells were cultured in Sf-900 II SFM medium (GIBCO) supplemented with 5% (v/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... and SuperScript II Reverse Transcriptase (Invitrogen Thermo Fisher Scientific; Cat #18064014) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: Nuclei were counted using a hemocytometer or CellCounter (Countess II, Invitrogen) and diluted to ∼ 1,000 nuclei/µL for single-nucleus capture on the 10x Genomics Chromium Next GEM Single Cell 3’v3 system following the standard user guide ...
-
bioRxiv - Biophysics 2024Quote: ... 1x Phire Hot Start II PCR Master Mix (ThermoFisher Scientific F125L). The reaction proceeded for 14 cycles of 98°C for 10 seconds ...
-
bioRxiv - Genetics 2023Quote: ... cDNA conversion was performed combining the SuperScript II Reverse Transcriptase (Invitrogen) with the Reverse Transcription System kit (Promega ...
-
bioRxiv - Immunology 2023Quote: ... Viability and cell count were assessed using a Countess II (ThermoFisher). Equilibrium to targeted cell recovery of 6,000 cells along with Gel Beads and reverse transcription reagents were loaded to Chromium Single Cell A to form Gel-bead-in Emulsions (GEMs) ...
-
bioRxiv - Pathology 2024Quote: ... and SuperScript II Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, USA). qPCR was carried out on StepOnePlus (Applied Biosystems ...
-
bioRxiv - Genetics 2023Quote: ... and cDNA was synthesized with SuperScript™ II Reverse Transcriptase (Invitrogen). The HAC1 spliced and unspliced fragments were amplified with intron-spanning primers (ACCTGCCGTAGACAACAACAAT and AAAACCCACCAACAGCGATAAT ...
-
bioRxiv - Immunology 2023Quote: ... Super Bright 645-labeled MHC II (M5/114.15.2, Thermo Fisher Scientific), BV421-labeled PD-L1 (MIH5 ...
-
bioRxiv - Genetics 2023Quote: ... 1 unit of Phusion Hot Start II DNA Polymerase (Thermo Fisher), 10 ul of 5X HF buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA was reverse transcribed using Superscript II Reverse Transcriptase (Life Technologies) with random primers (Invitrogen ...
-
bioRxiv - Biophysics 2023Quote: ... The bacmid was transfected to sf9 cells using Cellfectin-II (Invitrogen) to produce baculovirus ...
-
bioRxiv - Microbiology 2023Quote: ... or in Tab-Tek II CC2 chamber slides (Thermo Fisher Scientific). Separate wells were seeded for each assay to process ...
-
bioRxiv - Biophysics 2024Quote: The MDCK II cell lines were cultured in MEM (Gibco 410900028) with 5 % Fetal Bovine Serum (Sigma ...
-
bioRxiv - Biophysics 2024Quote: ... 1× Phire Hot Start II PCR Master Mix (ThermoFisher Scientific F125L). The reaction proceeded for 9 cycles of 98°C for 10 seconds ...
-
bioRxiv - Cancer Biology 2024Quote: ... prostates were harvested and subsequently digested with collagenase type II (Gibco) for 2 hrs at 37 °C ...
-
bioRxiv - Cell Biology 2024Quote: SuperScript II Reverse Transcriptase 200 U (Life Technologies, Carlsbad, CA, USA)
-
bioRxiv - Cell Biology 2024Quote: ... cDNA was synthesized using Superscript II RNase H-Reverse transcriptase (Invitrogen) and random hexamers (Applied Biosystems) ...
-
bioRxiv - Genomics 2024Quote: ... we utilized the Gateway BP Clonase II Enzyme Mix from Invitrogen to insert the 3’ UTR region into pDONR P2r-P3 Gateway entry vectors ...
-
“Identification of microRNAs regulated by E2F transcription factors in human pluripotent stem cells”bioRxiv - Developmental Biology 2024Quote: ... cDNA was generated using SuperScript™ II Reverse Transcriptase (Thermo Scientific) and miRNA-specific stem-loop primers as previously described [14] ...
-
bioRxiv - Genetics 2023Quote: ... The RT step was modified to utilize SuperScript II (Thermo Fisher) and a custom 5X First-Strand Buffer containing MnCl2 (250 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2023Quote: ... Muscles were minced with a sterile razor blade and transferred into digestion medium containing collagenase II and dispase II (Fisher Scientific, 17-101-015; 17-105-041) for enzymatic dissociation of mononuclear cells from muscle fibers in a rotating water bath at 37°C ...
-
bioRxiv - Plant Biology 2019Quote: ... UAS∷GAD2Δ and ALMT9 using Phire Hot Start II DNA Polymerase (Invitrogen) with primer sets:
-
bioRxiv - Cancer Biology 2021Quote: ... Reverse transcription was performed using the SuperScript II Reverse Transcriptase kit (Thermofisher). RT-qPCR was performed using Fast SYBR Green Master Mix (Thermofisher ...